báo cáo khoa học: " A cluster randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol" docx

báo cáo khoa học: " A cluster randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol" docx

báo cáo khoa học: " A cluster randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol" docx

... randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol Jasper ... format. This format is based on rational criteria for laboratory test registration to facilitate the integration of the individual databases in...

Ngày tải lên: 11/08/2014, 16:21

14 1K 0
báo cáo khoa học: " A cluster randomized controlled trial comparing three methods of disseminating practice guidelines for children with croup [ISRCTN73394937]" pptx

báo cáo khoa học: " A cluster randomized controlled trial comparing three methods of disseminating practice guidelines for children with croup [ISRCTN73394937]" pptx

... Alberta Ambulatory Care Classification System, the Alberta Health Care Insurance Plan (AHCIP) Payment Database, and the AHCIP Registry Dataset. All children 0–6 years of age and 6–16 years of age ... criteria Health care utilization using administrative databases Alberta Health and Wellness, a branch of the Alberta pro- vincial government, is the custodian of several data sour...

Ngày tải lên: 11/08/2014, 05:22

13 287 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... for cortical actin-patch polarization? What is the rela- tionship among cortical actin-patch polarization, endocytosis, and growth at elevated temperatures? Here we address these questions and show that ... localizes to cortical pat- ches that display a subcellular distribution polarized towards sites of surface growth and partially colocaliz- es with cortical actin patches. Vrp...

Ngày tải lên: 18/02/2014, 16:20

23 680 0
Báo cáo khoa học: Alternative binding proteins: Anticalins – harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities pdf

Báo cáo khoa học: Alternative binding proteins: Anticalins – harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities pdf

... complex between a cognate anticalin and the extracellular domain of CTLA-4 was solved, demonstrating that a macromolecular ‘protein antigen’ can be effectively bound at the cup-shaped binding site of an engineered lipocalin, ... further were made in a combinatorial approach using a ‘loop-walking’ randomization strategy [12] and also by rational protein design based on the cr...

Ngày tải lên: 23/03/2014, 07:20

7 404 0
Báo cáo khoa học nông nghiệp " Achievements and lesson learnt from implementation of the project "Sustainable community-based forest development and management in some high-poverty areas in Bac Kan Province" " pot

Báo cáo khoa học nông nghiệp " Achievements and lesson learnt from implementation of the project "Sustainable community-based forest development and management in some high-poverty areas in Bac Kan Province" " pot

... planning and land allocation to facilitate land distribution and address the sustainable management of the forest. The project Goal is Sustainable improvement in livelihood security of disadvantaged ... disasters happen in local areas. In addition, the implementation of CFM plan creates the equality and solidarity in the communities. Table 09. Impacts and changes d...

Ngày tải lên: 21/06/2014, 04:20

10 335 0
báo cáo khoa học: "Improved delivery of cardiovascular care (IDOCC) through outreach facilitation: study protocol and implementation details of a cluster randomized controlled trial in primary care" doc

báo cáo khoa học: "Improved delivery of cardiovascular care (IDOCC) through outreach facilitation: study protocol and implementation details of a cluster randomized controlled trial in primary care" doc

... will consist of analysis of both quantitati ve data and qualita- tive data. Quantitative analysis Descriptive statistics will be generated for all project vari- ables (means and standard deviations ... practice outreach facilitation trial in Canada to date. It builds on previous research in practice facilitation and attempts to translate research evide nce into practice in the...

Ngày tải lên: 10/08/2014, 11:20

14 415 0
báo cáo khoa học: "Design, rationale, and baseline characteristics of a cluster randomized controlled trial of pay for performance for hypertension treatment: study protocol" ppt

báo cáo khoa học: "Design, rationale, and baseline characteristics of a cluster randomized controlled trial of pay for performance for hypertension treatment: study protocol" ppt

... Pressure), and widespread comparative effectiveness trials such as the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) [ 4], translation into clinical practice has ... hypertensive patients randomized to doxazosin vs chlorthalidone: the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). JAMA 2000, 283:19...

Ngày tải lên: 10/08/2014, 11:20

12 353 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... Foster City, CA, USA). Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... x-5 gliadin gene, oligonucleo- tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin...

Ngày tải lên: 20/02/2014, 01:20

8 484 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... terms of training set size. We want to remind the reader that our two algorithms are aimed at small datasets. We randomly split each dataset into 10 subsets where each subset was a test set and ... the ratio of 9:1 we randomly split the data into training, validation and test sets with the ratio of 8:1:1. We then run our experiments and measured contingency table count...

Ngày tải lên: 20/02/2014, 04:20

9 558 0
w