báo cáo khoa học: " Developing a national dissemination plan for collaborative care for depression: QUERI Series" potx

... function in yeast G. Bartish et al. 529 2 FEBS Journal 27 4 (20 07) 528 5 529 7 ê 20 07 The Authors Journal compilation ê 20 07 FEBS Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function ... The transformed cells were G. Bartish et al. Role of Thr56 and Thr58 for eEF2 function in yeast FEBS Journal 27 4 (20 07) 528 5...

Ngày tải lên: 07/03/2014, 05:20

... moderator. 7 Similarly, the “Question” speaker had a relatively high variance, consistent with an amalgamation of many distinct speakers. These topic shift tendencies suggest that all can- didates manage to ... closely what we can learn about speakers’ topic shift ten- dency. We verified that SITS can segment topics, and assuming that changing the topic is useful for a speaker,...

Ngày tải lên: 07/03/2014, 18:20

... The Authors Journal compilation ê 2006 FEBS Multi-tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation Kathleen L. Hefferon 1 , Yong-Sun ... conditions. Finally, regulation of BeYDV CP expression was examined. The discovery of an unconventional mechanism of translational initi- ation is discussed...

Ngày tải lên: 16/03/2014, 13:20

... FrancescXavier.Aviles@uab.es Abbreviations: PCPAHa, procarboxypeptidase from Helicoverpa armigera; PCPAHaa, procarboxypeptidase a from Helicoverpa armigera; CPAHa, carboxypeptidase from Helicoverpa armigera; CPA1h, ... synthesized to amplify the cDNA containing the procarboxypeptidase by PCR. Sense primer 5Â-GATTCT CTCGAGAAAAGAAAACATGAAATTT ATGATGG-3Â; antisense pr...

Ngày tải lên: 17/03/2014, 03:20

... the options are American, Pizza, and Italian. Most of them are located in Boston and Cambridge. SIM: Any restaurants in Back Bay? SYS: There are 57 restaurants in Back Bay. Many of them are American, and ... yields greater robustness against changes in the database contents. 3.2 Dialog Management The domain-independent dialog manager is config- urable via an external dialog control table...

Ngày tải lên: 23/03/2014, 19:20

... Authors Journal compilation ê 2009 FEBS Structural framework of the GABARAP–calreticulin interface – implications for substrate binding to endoplasmic reticulum chaperones Yvonne Thielmann 1 , Oliver ... shown). Obviously, the mutation shifted the dissociation constant from 11.5 lm into the millimolar range. We conclude that the tryptophan side chain p...

Ngày tải lên: 30/03/2014, 02:20

... peggy.tso@utoronto.ca 1 Department of Health Policy, Management and Evaluation, University of Toronto, Toronto, ON, Canada Full list of author information is available at the end of the article Tso et al. ... Open Access Developing a decision aid to guide public sector health policy decisions: A study protocol Peggy Tso 1,2* , Anthony J Culyer 1 , Melissa Brouwers...

Ngày tải lên: 10/08/2014, 10:23

... distribution, and reproduc- tion in any medium, provided the original work is properly cited. Review Developing effective chronic disease interventions in Africa: insights from Ghana and Cameroon Ama ... Aikins et al., Developing effective chronic dis- ease interventions in Africa: insights from Ghana and Cameroon Globaliza- tion and Health 2010...

Ngày tải lên: 11/08/2014, 14:21

... imple- mentation. Role of organizational factors in the QUERI model of implementation research Evaluation of the influence of organizational characteris- tics on the quality of care has gained in its salience ... inter- related to other evaluation activities. The role of organizational research in the QUERI model One of the foundations of...

Ngày tải lên: 11/08/2014, 16:21

... infrastructure and organizational support for national dissemination and implementation Table 3: Guidance for National Dissemination Plan Action Team Leaders Action Team assembly and composition ▪ Team leaders ... collab- orative care models for depression, and related perform- ance targets for implementation (goals 2 and 3). Table 5: TIDES National Dissemination Plan...

Ngày tải lên: 11/08/2014, 16:21

... if they would be willing to participate in a survey of attitudes toward and support for a number of harm reduction strategies. One manager declined. Each manager was asked to suggest a therapist ... Central Page 1 of 20 (page number not for citation purposes) Harm Reduction Journal Open Access Research Barriers to the dissemination of four harm reduc...

Ngày tải lên: 11/08/2014, 18:20

... use and sexual behaviors prior to and during incarceration, tattoo- ing, access to medical care and past medical history was provided to all inmates. Overall, 72% of inmates agreed to participate ... inclusion and exclusion criteria, information was collected and analyzed about HIV, HBV and HCV prevalence, risk practices, mortality, access to harm reduction m...

Ngày tải lên: 11/08/2014, 18:20

... (added with standard error of means) of the set of EuroQol-5D health states derived by three different measurement methods (ranking, VAS, TTO) presented for the general population and for the ... Groningen, University of Groningen, Groningen, The Netherlands Full list of author information is available at the end of the article Krabbe et al. Health and Quality of Li...

Ngày tải lên: 12/08/2014, 01:22

... Portuguese intensive care physicians have already participated in a European survey conducted by Vincent [10] in 1996, a small number were included (24 physicians), and a national survey of Portuguese ... Available online http://ccforum.com/content/7/6/R167 Research Life-sustaining treatment decisions in Portuguese intensive care units: a national...

Ngày tải lên: 12/08/2014, 20:20

... and pathophysiology: implications and relevance for intensive care medicine Michael Grocott, Hugh Montgomery and Andre Vercueil Centre for Altitude, Space and Extreme Environment Medicine (CASE ... population and environmental challenge, in contrast to those observed on critical care units, as well as the availability of ‘premorbid’ Review High-altitude physiology...

Ngày tải lên: 13/08/2014, 03:20