báo cáo khoa học: " Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study" pps

... Science Open Access Research article Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study Mar a Eugenia Esandi* 1 , Zulma Ortiz 1 , Evelina Chapman 1 , ... Universidad de Buenos Aires, Argentina and 4 Hospital de Pediatr a "Prof. Dr. Juan P. Garrahan", Buenos Aires, Argentina Email: Mar a Eugenia...

Ngày tải lên: 11/08/2014, 16:21

... GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified ... tyrosinase was also inactivated completely within 20 min [40]. In general, mammalian and plant-derived tyrosinases are not very thermostable; even a short incubation at 70–90 °C inac- ti...

Ngày tải lên: 19/02/2014, 06:20

... containing DOPA and tyrosinase, the rate of substrate oxidation Fig. 3. Representative chromatograms of the autoxidation and tyrosinase-mediated oxidations of DOPA, with and without cata- lase. ... of NaCl ⁄ P i (pH 7.4) that lacked catalase (A and B) and those with catalase (C). Arrows indi- cate times when dopamine was incorporated in the reaction mix- tures. Pulse volt...

Ngày tải lên: 07/03/2014, 17:20

... (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order to introduce an NcoI restriction site, an extra alanine codon (GCA) was introduced ... preculture was used to inoculate 1 L Luria–Bertani medium with kanamycin and spectinomycin (both 50 mgÆL )1 ) in a 2-L conical flask and incubated in a rotary sh...

Ngày tải lên: 16/03/2014, 14:20

... anti- gens. Diagnosis Aspf1 D(7–22) vs. Aspf1 a a-sarcin vs. Aspf1 a a-sarcin D(7–22) vs. Aspf1 a a-sarcin D(7–22) vs. a- sarcin a Asthma 33 33 50 20 Cystic fibrosis 50 30 89 33 ABPA 20 33 70 22 a Data calculated ... (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢). These primers contained BstEII and BamHI sites and were used to generate a fragment that was cloned in...

Ngày tải lên: 16/03/2014, 19:20

... HIV vaccine. The availability of an optimal adjuvant and carrier to enhance antiviral responses may accelerate the development of a vaccine candidate against HIV. The aim of this study was to investigate ... Lehar SM, MacCafferty J, Chiswell D, Blattler WA, Guild B: Phage display of ricin B chain and its single binding domains: system for screening galactose-binding mutants. Pro...

Ngày tải lên: 12/08/2014, 04:21

... action of superoxide dismutase or catalase, implicating the involvement of a peroxo adduct in catalysis [243]. In fact, reactivity was enhanced when H 2 O 2 was the oxidant in p lace of reductant and ... (1983) Mechanisms of extrahepatic bioactivation of aromatic amines: the r ole of he moglobin in the N-oxidation of 4-chloraniline. In Extr ahepatic Drug Me tabolis...

Ngày tải lên: 19/02/2014, 16:20

... skilled technical assistance in molecular biology, and Kati Vena ¨ la ¨ inen and Leena Penttila ¨ for assistance in HPLC and MALDI-TOF MS analysis. The work was supported in part by Research Grants of the Academy ... of fucokinase were subcloned into the XbaI site of a pQM vector containing a C-terminal E2-Tag /A (Quattromed Ltd, Tarto, Estonia). The forward primer was...

Ngày tải lên: 30/03/2014, 13:20

... largely based on the combined evaluation of clinical signs, laboratory and epidemiological data. Since most physicians are unfamiliar with HME, this disease is often misdiagnosed and many cases ... ticks in Japan. J Clin Microbiol 2000, 38, 1331-1338. 28. Uhaa IJ, MacLean JD, Greene CR, Fishbein DB. A case of human ehrlichiosis acquired in Mali: clinical and laboratory fin...

Ngày tải lên: 07/08/2014, 18:21

... that A. cephalonica, A. cilicica and A. nordmanniana exhibit a range of indices, with the lowest near to 30. Meanwhile A. alba, A. bornmulleriana, A. equi-trojani, A. marocana, A. pinsapo and A. borisii ... burst: Abies cephalonica and Abies cilicica; average bud burst: Abies alba, Abies numidica, Abies marocana, and Abies pinsapo; late bud burst: Abies nordmanniana and...

Ngày tải lên: 08/08/2014, 14:20