báo cáo khoa học: " Toward a policy ecology of implementation of evidence-based practices in public mental health settings" doc

báo cáo khoa học: " Toward a policy ecology of implementation of evidence-based practices in public mental health settings" doc

báo cáo khoa học: " Toward a policy ecology of implementation of evidence-based practices in public mental health settings" doc

... Substance Abuse and Mental Health Services Administration: About Evidence-Based Practices: Shaping Mental Health Services Towards Recov- ery. Rockville, MD: USDHHS, Substance Abuse and Mental Health Services ... citation purposes) Implementation Science Open Access Debate Toward a policy ecology of implementation of evidence-based practices in public me...

Ngày tải lên: 11/08/2014, 16:21

9 339 0
Báo cáo khoa học: "Toward a Redefinition of Yea/No Questions" pot

Báo cáo khoa học: "Toward a Redefinition of Yea/No Questions" pot

... affirmable v:due would be negating the lowest deniable scalar. In such a denial a speaker may implicate his affirmation or ignorance of lower scalars. So, in exchanges like { 9a) , a value higher ... UlU,n a number of metrics and may involve the affirmation or negation of higher, lower, or alternate values. They may also involve the affirmation or denial of more than...

Ngày tải lên: 17/03/2014, 19:21

4 331 0
Báo cáo khoa học: "Toward a Plan-Based Understanding Model for Mixed-Initiative Dialogues" pptx

Báo cáo khoa học: "Toward a Plan-Based Understanding Model for Mixed-Initiative Dialogues" pptx

... an individual speaker's domain plans may be activated at any point in the dialogue. We propose an extension to the Litman and Allen model by relaxing the shared domain plan constraints. ... that SpA and SpB do not share the Register domain plan at that point in the dialogue. Another example of speaker planning that the Lit- man and Allen model cannot explain, occurs in D...

Ngày tải lên: 23/03/2014, 20:20

8 253 0
báo cáo khoa học: " Toward a treaty on safety and cost-effectiveness of pharmaceuticals and medical devices: enhancing an endangered global public good" pot

báo cáo khoa học: " Toward a treaty on safety and cost-effectiveness of pharmaceuticals and medical devices: enhancing an endangered global public good" pot

... for clinical pharmacology. Medical Journal of Australia 2005, 182(7):322-323. 14. Australian Government Department of Health and Ageing: National Medicines Policy. [http://www .health. gov.au/internet/wcms/pub lishing.nsf/Content/nmp-objectives -policy. htm]. ... States now have an increasing policy interest in this area, though institutional arrangements, particularly in the are...

Ngày tải lên: 11/08/2014, 18:20

9 448 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ ... causes the fatal human sleeping sickness, as well as Nagana, a devastating disease of domestic animals in large parts of sub-Saharan Africa. While many aspects of trypanosome cell...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... chromatin incorpor- ating them. To see whether the increased transcription leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a time-dependent ... B area) become deacetylated whereas the acetylation of both H3 and H4 of nuclesome F was increased [42]. Addition of TSA resulted in only an insignificant increase of...

Ngày tải lên: 19/02/2014, 12:20

10 501 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf

Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf

... Dan Melamed. 2003. Evaluation of Machine Translation and its Evaluation. In In Proceedings of MT Summit IX, New Orleans,LA. C. Lin and E. H. Hovy. 200 3a. Automatic Evaluation of Summaries Using ... ORANGE (Lin, 2004), which evaluates a similarity metric using the average ranks obtained by reference items within a baseline set. As in our framework, ORANGE performs an automatic m...

Ngày tải lên: 17/03/2014, 05:20

10 518 0
Báo cáo khoa học: Flavogenomics – a genomic and structural view of flavin-dependent proteins potx

Báo cáo khoa học: Flavogenomics – a genomic and structural view of flavin-dependent proteins potx

... (family FAD_bind- ing_9 in the clan FAD_Lum_binding). In addition, a novel covalent attachment between a side chain car- boxylate group of an aspartate and the 8a- position of the isoalloxazine system ... are available for about half of the flavo- proteins. FAD-containing proteins predominantly bind the cofactor in a Rossmann fold ( 50%), whereas FMN-containing proteins pref...

Ngày tải lên: 28/03/2014, 22:20

10 460 0
Báo cáo khoa học: Flavogenomics – a genomic and structural view of flavin-dependent proteins ppt

Báo cáo khoa học: Flavogenomics – a genomic and structural view of flavin-dependent proteins ppt

... and a siderophore-interacting protein (family FAD_bind- ing_9 in the clan FAD_Lum_binding). In addition, a novel covalent attachment between a side chain car- boxylate group of an aspartate and ... is located in a central cavity of the protein, and engages in hydrogen bond interactions with several amino acid side chains. In this case, it seems plausible that the flavin p...

Ngày tải lên: 28/03/2014, 22:21

10 271 0
Từ khóa:
w