báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''''''TRY-ME''''''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf
báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pps
... ProgramOHIP – Ontario Health Insurance PlanOPEM – Ontario Printed Educational MaterialPEM – Printed Educational MaterialTACT – Target, Action, Context, TimeTPB – Theory of Planned BehaviourCompeting ... for citation purposes)Implementation ScienceOpen AccessStudy protocol Testing a TheoRY-inspired MEssage ('TRY-ME'): a sub-trial within the Ontario Printed Educational Message (OPEM) ... controlled trial of printed educational materials (the Ontario printed educational mes-sage, OPEM) to improve referral and prescribing practices inprimary care in Ontario, Canada. Implement...
- 8
- 126
- 0
báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf
... purposes)Implementation ScienceOpen AccessStudy protocol Testing a TheoRY-inspired MEssage ('TRY-ME'): a sub-trial within the Ontario Printed Educational Message (OPEM) trialJillian J Francis*1, ... ProgramOHIP – Ontario Health Insurance PlanOPEM – Ontario Printed Educational MaterialPEM – Printed Educational MaterialTACT – Target, Action, Context, TimeTPB – Theory of Planned BehaviourCompeting ... Ottawa, Ottawa, Canada, 4Institute of Clinical Evaluative Sciences, Toronto, Ontario, Canada, 5Department of Health Policy Management and Evaluation, University of Toronto, Toronto, Canada;...
- 8
- 163
- 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx
... pro-inflam-matory mediators is probably a result of the fact thatinflammatory transcription factors such as nuclearfactor-kappaB, activator protein-1 and nuclear factorof activated T-cells are ... ItalyTherapeutic strategies aimed at reducing brain dam-age after ischemic stroke have been a major focus ofacademic and industrial research for the past30 years. Two primary therapeutic approaches ... brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue tostroke treatmentFlavio Moroni and Alberto ChiarugiDepartment of Preclinical and Clinical Pharmacology,...
- 10
- 417
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... of dopamine and a- synuclein interplayin a cellular model of Parkinson’s disease pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia Bruna Gariboldi1,Giovanna ... kinase, 60Sacidic ribosomal protein P2 (RPLP2), eukaryoticinitiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12,annexin A2 , annexin A5 , aldolase A, fascin 1 andperoxyredoxin 1] displayed quantitative ... with the plasmid containing human a- synuclein cDNA (a- syn). As a control, we usedSH-SY5Y cells stably transfected with the plasmidcontaining b-galactosidase cDNA (b-gal). Western blotanalysis...
- 11
- 775
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... release of adenine-lack-ing cobalamins, such as CN-Cbl and damaged cofac-tor. The fact that the relative efficiencies of metal ionsfor the reactivation are not always correlated with the ATPase ... of the reactivase also suggested that the interactions between the reactivase a and b subunitsare weakened at least partially by the ADP binding[25]. The space that is opened by the dissociation ... the enzymeÆreactivase complex was formed in smallamounts from apoenzyme and the reactivase and not atall from the enzymeÆCN-Cbl complex and the reactivase(data not shown).Affinity of the reactivase...
- 13
- 620
- 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... agitation at200 rpm unless otherwise stated.Enzymatic activity assay and characterization The assay for hydantoinase activity was performed at 40 °Cwith constant shaking. The reaction mixture contained50 ... into the molecular basis of enzyme thermosta-bility. J Bacteriol 185, 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino ... allantoate amido-hydrolase, which is part of the urate catabolic pathwayin many organisms [8]. In fact, by genome data mining,another hydantoinase (HYD) was also found in the Jannaschia sp. CCS1 genome...
- 14
- 621
- 0
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx
... cellu-lar networks allows the simplification of the set ofequations by assuming a steady state of the intra-cellular metabolites. An approach that combines fluxbalance analysis (FBA) with an ordinary ... adenylatecyclase (CyaA) and leads to an increase in the intra-cellular cyclic AMP (cAMP) level [1].Mathematical models of cataboliterepression in E. coli The (isolated) reactions of the PTS have ... of[15].cData are scaled for the wild-type: that is, the values obtainedfor the wild-type are set to unity and the measurements for the mutant strains are taken as values relative to the wild-type value.10−610−410−2100...
- 9
- 723
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI siteand an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure ... assaysPhosphatase activity of St SurE was measured againstpNPP, a general substrate for all phosphatases. pNPP isconverted to para-nitrophenol by the phosphatase, the formation of which can...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... both outer reverse ACGAAACCTGGCAGAGTCCAAG B6R5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R7 both forward CAGAAAAAGACAAGGAGGAC F19RIsoform-specific ... 8 both forward ACAACACCACTGCTGCGGAGTTA J1F9 short reverse ACATCAAGGAGCGTTAGAATCTAA J2R 1201 (with J1F and J2R)10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 1385 (with J1F and J3R)Real time PCR...
- 11
- 662
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...
- 14
- 517
- 0
Từ khóa: Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ