Báo cáo y học: " Comparative efficacy and acceptability of methylphenidate and atomoxetine in treatment of attention deficit hyperactivity disorder in children and adolescents: a meta-analysis" pdf
Báo cáo y học: " Comparative efficacy and acceptability of methylphenidate and atomoxetine in treatment of attention deficit hyperactivity disorder in children and adolescents: a meta-analysis" pdf
... of methylphenidate and atomoxetine in treatment of attention deficit hyperactivity disorder in children and adolescents: a meta-analysis Raveen Hanwella, Madhri Senanayake and Varuni de Silva * Abstract Background: ... 81%). Conclusions: In general atomoxetine and methylphenidate have comparable efficacy and equal acceptability in treatment...
Ngày tải lên: 11/08/2014, 16:20
Báo cáo y học: " Comparative efficacy of the Cognitive Behavioral Analysis System of Psychotherapy versus Supportive Psychotherapy for early onset chronic depression: design and rationale of a multisite randomized controlled trial" ppt
... monitoring of adherence CBASP and SP are implemented by two separate groups of psychotherapists, both trained (in a 2-day training workshop and at least 1 practice day) in one of the methods and ... randomi- zation database, so that all randomizations have to be accounted for. Audit log files detailing all activity on the randomization system are available to the trial coordi...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "A second-generation autologous chondrocyte implantation approach to the treatment of focal articular cartilage defects" ppsx
... Institute of Arthritis, and Musculoskeletal and Skin Diseases, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland 20892, USA Corresponding author: Rocky S Tuan, ... may Commentary A second-generation autologous chondrocyte implantation approach to the treatment of focal articular cartilage defects Rocky S Tuan Cartilage Biology and O...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"
... better AKBA bioavailability than 5-Loxin ® in Wistar rat model. Broad spectrum safety of Aflapin was also established in a battery of acute and sub-acute toxicity studies in rat and rabbits. ... design- ing the study, conducting data analysis and writing the manuscript. Abbreviations AKBA: 3-O-acetyl-11-k e t o -beta-boswellic acid; ANOVA: analysis of variance; ASRA...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"
... metabolism and probably cataract formation. In this paper, we study serum level of Na + and K + in senile cataract patients and normal individuals. Methods and materials: 155 senile cataract patients ... Epidemiological aspects of age related cataract. In: Tasman W, Jaeger A, eds. Duane’s Clinical Ophthalmology. Philadelphia: Lippincott-Raven publishers, 2000:12-14. 9....
Ngày tải lên: 03/11/2012, 09:49
Báo cáo khoa học: "Comparative efficacy of standard AGID, CCIE and competitive ELISA for detecting bluetongue virus antibodies in indigenous breeds of sheep and goats in Rajasthan, India" potx
... State of India. Since, the serological testing of small ruminants for anti-BTV antibodies is still mainly based on AGID test, we also investigated the comparative efficacy of the presently available ... breeds indicating that the local breeds of sheep may serve as a potential reservoir of BTV infection and may also transmit the infection to cattle and other breeds of she...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: "Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes" pot
... linkage geometry and the stability of RNA. RNA 1999, 5:1308-1325. 28. Ueland PM: Pharmacological and biochemical aspects of S -adenosylhomocysteine and S-adenosylhomocysteine hydrolase. Pharmacol ... RF01687 Actino-pnp Y Y N Actinomycetales RF01688 AdoCbl-variant Y Y Y Marine RF01689 asd Y ? ? Lactobacillales RF01732 atoC y y?δ-Proteobacteria RF01733 Bacillaceae-1 Y n n...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: "Comparative genomics reveals birth and death of fragile regions in mammalian evolutio" pdf
... (for adjacent branches like M+ and R+), green (for branches that are separated by a single branch like M+ and D+ separated by MR+), and yellow (for branches that are separated by two branches ... contributions Both authors participated in data analysis and writing the manuscript. MA also performed the simulations and prepared illustrations. Both authors read and approved the f...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: "Comparative genomics of the social amoebae Dictyostelium discoideum and Dictyostelium purpureum" ppt
... AGTTCCTTCATTCT AAGAAAACC TCCGTCAAC Dd_r28 GTTGACCTTACAGCAATCTAATC ACAAATTTTTACTTCAC AAAAAAAAAACCCCTTCGTCAAC Dd_r41 GTTGACCTTACAGCAAATCTTAA AGCTACTTCATTCT AAGAAAAAC TCCTGTCAAC Dd_r47 GCTGACCTTACAGCAATTCTATC ... ATTCAAAATTTAAC TCTGAAAT CTTGAATTC Dp_11 GAATTCCTTACAGCAATTAAACT C ATTCAAAATTTAAC TCTGAAAT CTCGAATTC Dp_19 GAATTCCTTACAGCAATAAACTT GACTCTGAAATCTT AAATTC Dp_2 GAATTCCTTACAGCAATTA-CAT TATT...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: " Comparative analysis of cell culture and prediction algorithms for phenotyping of genetically diverse HIV-1 strains from Cameroon" pps
... 5'- CACTTCTCCAATTGTCCCTCA and sequences were edited, aligned in Clustal program and translated into amino acids as described in the algorithm. Plasma VL was determined using the Versant HIV RNA 3.0 Assay (bDNA; Siemens, ... 1 Laboratory of Molecular Virology, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892, USA and 2 Depar...
Ngày tải lên: 10/08/2014, 05:21