báo cáo khoa học: " Applying the quality improvement collaborative method to process redesign: a multiple case study" pot

... corpus, and is compared with the results of the baseline BLEU method with respect to their correlation with human evaluation scores. The scores produced by the N-gram model with tf.idf and S-Score ... used). The scores for both runs were compared using a standard deviation measure. 3. The results of the MT evaluation with frequency weights With respec...

Ngày tải lên: 20/02/2014, 16:20

... primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and TEHA4: ACACCCATGGT- CTGTTTCCTGTG ... bacterial strain and the solubility of the target protein are other parameters that affect total protein production, as well as the amount of soluble protein. Commonly used p...

Ngày tải lên: 06/03/2014, 01:20

... random from the learning set; these constituted the data on which an initial classifier was trained. The rest of the words in the learning set formed the unlabelled pool for active learning; their phonemes ... the English CMU data; the data from the other five languages did not influence these choices. The letter context con- sisted of the focus letter and the 3 letters...

Ngày tải lên: 23/03/2014, 16:21

... extracted using the default settings of the Moses SMT toolkit. The 4-gram back-off target LM is trained on the English part of the bitexts and the Gigaword corpus of about 3.2 billion words. Therefore, ... not useful to query on. The stop word list provided by the IR Group of University of Glasgow 4 was used. The resources required by our system are min- imal :...

Ngày tải lên: 31/03/2014, 20:20

... score of 54 points was possible). Panel C plots the log of MSJ ratio against the SIAS scores. Panel D plots the log of the MSJ ratio against FMA-UE. The dashed line shows the linear fitting of the ... we hypothesized that, in stroke patients, the curvature increases even in the middle of reaching due to the patient’s inability to control the movement a...

Ngày tải lên: 19/06/2014, 08:20

... submission of the sequence string from the beginning of the first peptide until the end of the last peptide for a BLASTp homology search. The output of the BLASTp search was then further analysed ... number of homologous sequences, names of the proteins, the percentage of sequence similarity and the position of the query sequence in the conti...

Ngày tải lên: 07/08/2014, 23:22

... 1 of 21 (page number not for citation purposes) Radiation Oncology Open Access Methodology On the performances of different IMRT treatment planning systems for selected paediatric cases Antonella ... was conducted also for the DVHs of the separate courses. In this case, the results for the TPS of the second family, are poorer for the boost fo...

Ngày tải lên: 09/08/2014, 10:21

... organizations, and other or ganizations that have recrui ted and trained community healthcare providers for clinical trials and clinical research networks and/ or have key information regarding clinical ... 6:34 http://www.implementationscience.com/content/6/1/34 Page 7 of 11 RESEARCH Open Access Bridging the gap between basic science and clinical practice:...

Ngày tải lên: 10/08/2014, 10:23

... Applying mass spectrometry based pro- teomic technology to advance the understanding of multiple myeloma Jour- nal of Hematology & Oncology 2010, 3:13 Micallef et al. Journal of Hematology ... receptor in MM. Importantly their mass spectrometry approach demonstrated the potential for pharmacodynamic monitoring. The future of mass spectrometry in biom...

Ngày tải lên: 10/08/2014, 22:21

... the exchange of the standardised change ideas in such a way that they can eliminate much of the investigative work on problem analysis and change ideas in comparison with traditional quality project ... investigate the causes of waiting times and delays and to tailor change ideas to their own setting. As a consequence, the collaborative cannot eliminate the investigati...

Ngày tải lên: 11/08/2014, 05:21

... RESEARCH Open Access Applying the Stages of Change model to Type 2 diabetes care in Trinidad: A randomised trial VA Partapsingh 1 , RG Maharaj 2* and JM Rawlins 2 Abstract Objective: To improve ... there was a simultaneous increase in the number of patients in the action and maintenance stages (collectively) at the end of the study. In...

Ngày tải lên: 11/08/2014, 07:21

... 11:82 http://www.biomedcentral.com/1471-2229/11/82 Page 3 of 10 CORR E C T ION Open Access Assessing the contribution of alternative splicing to proteome diversity in Arabidopsis thaliana using proteomics data Edouard I Severing 1,2,3 , ... by themselves not very indicative for the contribution of AS to the proteome diversity in A. thaliana. Thi...

Ngày tải lên: 11/08/2014, 11:20

... in the evaluated collaborative A. Testing and implementing changes according to the QIC methodology Idea 2 Part a , Idea 2 Part b , Idea 2 Part c, Idea 2 Part d , Idea 2 Idea 3 Part a , Idea ... investigate the causes of waiting times and delays and to tailor change ideas to their own setting. As a consequence, the collaborative cannot eliminate the investigative...

Ngày tải lên: 11/08/2014, 16:20

... gender and torus mandibularis affect mandibular cortical index? A cross-sectional study Serdar Uysal* 1 , Berna L ầarankaya 2 and Müjgan Güngör Hatipoğlu 3 Address: 1 Hacettepe University Faculty ... ME: Palatal tubercles, palatal tori, and mandibular tori: Prevalence and anatomical fea- tures in a US population. J Periodontol 1999, 70:329-336. 24. Reichart PA,...

Ngày tải lên: 12/08/2014, 00:20