báo cáo khoa học: " The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial" ppsx

... therapists;average therapist age; percentage of Caucasian thera-pists; percenta ge of male therapists; and AAFT staff rat-ings of expected performance. This last measure wasused to take into account any ... current paper describes the design and baselinecharacteristics of the therapists participating in the Rein-forcing Therapist Performance (RTP) study, which is a cluster randomized experiment examining ... 5:5http://www.implementationscience.com/content/5/1/5Page 8 of 12 STUDY PROT O C O L Open Access The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trialBryan R Garner1*, Susan H Godley1, Michael...

Báo cáo y học: "The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial" potx

... percentage of male clients; number of therapists;average therapist age; percentage of Caucasian thera-pists; percenta ge of male therapists; and AAFT staff rat-ings of expected performance. ... this article as: Garner et al.: The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial.Implementation Science 2010 5:5.Submit your next manuscript ... operating costs, the reinforcement costsare the costs associated with providing the monetaryincentives to therapists as part of the RTP study, andare calculated as a total of the payments themselvestimes...

báo cáo khoa học: " The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma – report of a case" pptx

... leiomy-osarcoma, lipoma, liposarcoma, neurofibroma, schwan-noma, malignant peripheral nerve sheath tumour,hemangioma, angiosarcoma) and from salivary glands(pleomorphic adenoma, adenoid cystic carcinoma ... although the hard palate and the gin-giva are the most common intraoral sites of occurrence[10]. Oral metastatic lesions can also be the initial appear-ance of undiagnosed primary malignancies. ... CentralPage 1 of 5(page number not for citation purposes)Head & Face MedicineOpen AccessCase report The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma...

Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf

... be addressed before a large scaleclinical and cost effectiveness evaluation of this approach.Specifically, the trial will provide extensive quantitativeand qualitative data on the acceptability ... contact with a professional/paraprofessional, and a CBT (CognitiveBehaviour Therapy) rather than educational model [10].Self-man agement approaches can increase disseminationof evidence ba sed ... regression,respectively.Qualitative dataAnalysis will be carried out byamultidisciplinaryteamof psychologists, nurses, relatives and researchers. Toensure that the analysis is grounded in the data, ratherthan reflecting...

báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

... addition, they will besent similar, but separate, basic quarterly and annual feed-back reports containing data on the extended in dicatorset. Also, support by the NICE data managers is availableand ... combine manual entry of data usingdedicated software with automated data extractions fromelectronic patient records available in, e.g.,theirpatientdata management system. Each month, participantsupload ... participantsupload their data from the local, electronic database to the central, electronic registry database. ICUs in the interven-tion arm that have not submitted their data at the end of a month...

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... analysis of the study. MS conceived and coordinated the study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and approved the final manuscript.AcknowledgementsAll ... and are not related to the presence of abnormalitieson the CXR. Unfortunately, these abnormalities formed a sub-stantial part of all new and unexpected abnormalities in ouranalysis (1.0% and ... on the day the CXR was performed. Similar to the ICU physicians, the radiologist structurally interpreted the CXR for eachpatient (for example, the radiologist ticked whether radiologi-cal abnormalities...

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... 5-GACGAGATTATCAGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAGAGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATGAGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3.AcknowledgementThis project was supported by grants from the Aus-trian Science ... ACTIN2gene as an internal standard. PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGTGCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAGAATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATCAGATTTTACGC-3 ... SJ, Ward ER, RyalsJA & Dangl JL (1994) Arabidopsis mutants simulatingdisease resistance response. Cell 77, 565–577.26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,Miyao A, Kawasaki T,...

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2)SJS138 TACGAGATCTTAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2)SJS172 GGGATCATGCCCAAGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2)SJS173 AGTAAGGAAAATAAGCTTGGGCATGATCCC Reverse ... 1520–1491 PAI-2)SJS174 GCTCACTGCCTAAGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2)SJS175 CTTTATTAGCTACAAAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2)SJS259 CTTTGTTATTTATTATGCATTCCTATGGTGAGTT Forward...

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... 5¢-GGTATTGAGGGTCGCCATGGTTATGTTCAATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAGAGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCRproduct was puriﬁed, treated with T4 exonuclease tocreate vector-compatible overhangs and annealed ... FEBScontaining 100 lm of (GlcNAc)1–4was analysed at the start, in the middle and at the end of each series of sam-ples. The resulting average values of the standards (display-ing standard deviations ... N, Miyahara M, Miyam-oto K, Yasuda M & Inamori Y (2002) Identiﬁcationand characterization of the gene cluster involved inchitin degradation in a marine bacterium, Alteromonassp. strain...

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... 88,12–19.19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004)Identiﬁcation of the ﬁrst archaeal type 1 RNase H genefrom Halobacterium sp. NRC-1: archaeal RNase HI cancleave an RNA-DNA junction. ... chromosomal DNA during mammalian Okazakifragment processing. J Biol Chem 272, 22591–22599.9 Haruki M, Tsunaka Y, Morikawa M & Kanaya S(2002) Cleavage of a DNA-RNA-DNA ⁄ DNA chimericsubstrate ... bifunctional enzyme consisting of an RNase Hdomain and an acid phosphatase domainNaoto Ohtani1, Natsumi Saito1, Masaru Tomita1, Mitsuhiro Itaya1,2and Aya Itoh11 Institute for Advanced...

Xem thêm