báo cáo khoa học: " Improving outcomes for ill and injured children in emergency departments: protocol for a program in pediatric emergency medicine and knowledge translation science" potx
báo cáo khoa học: " Improving outcomes for ill and injured children in emergency departments: protocol for a program in pediatric emergency medicine and knowledge translation science" potx
... Ottawa, Ottawa, Canada, 4Department of Pediatrics, Faculty of Medicine, University of Calgary, Calgary, Canada, 5Departments of Pediatric and Emergency Medicine, University of Ottawa, Ottawa, ... jbrehaut@ohri.ca; Ian D Graham - igraham@cihr-irsc.gc.ca; Gillian Currie - currie@ucalgary.ca; Nicola Shaw - nicola.shaw@capitalhealth.ca; Maala Bhatt - maala.bhatt@muhc.mcgill.ca; Tim Lynch ... Tim.Lynch@lhsc.on.ca; Liza Bialy - lbialy@ualberta.ca; Terry Klassen - terry.klassen@ualberta.ca* Corresponding author AbstractApproximately one-quarter of all Canadian children will seek emergency care in any...
- 7
- 231
- 0
báo cáo khoa học: " TRIPS, the Doha Declaration and increasing access to medicines: policy options for Ghana" pdf
... pharmaceu-tical market share. There are about 30 pharmaceuticalmanufacturing facilities in Ghana and about 17–18 pro-duce all year round. Most raw materials needed for localmanufacture are ... regulations relating to drug access issues in Ghana and internationally), interviews with key stakeholders and informants to identify major gaps in drug access in Ghana, and inputs from the Access ... supply managementchain need examination and adjustment to make medi-cines more affordable for patients.Ghana has potential to supply more of its medicine needs;local manufacturing accounts for...
- 10
- 307
- 0
báo cáo khoa học:" Combination of surgical excision and custom designed silicon pressure splint therapy for keloids on the helical rim" ppt
... the operation a combination of 0.5 ml triamci-nolonacetonid and scandicain 2 % was intralesionallyinjected. The custom made silicon splint was applieddirectly after surgery and steroid injection ... Boorboor3, Benno Mann1, Peter Altmeyer4, Klaus Hoffmann4 and Falk G Bechara4Address: 1Department of General and Visceral Surgery, Augusta Kranken Anstalt, Academic Teaching Hospital of the ... ears present several therapeutic challenges.They are common after small skin excisions and otherprocedures, including drainage of auricular hematomas,repair of other auricular traumas, or as...
- 4
- 311
- 0
Báo cáo khoa học: Regulated expression by PPARa and unique localization of 17b-hydroxysteroid dehydrogenase type 11 protein in mouse intestine and liver pdf
... pCMVtag 5A. To obtain anexpression plasmid for 17b-HSD11 with a Halo-tag at theC-terminus, a DNA fragment was amplified by PCR withprimers 5¢-AAAgctagcGTTTAGGACCGGGAAC (addedNhe site in lower case) ... C-terminus, a DNA fragment was amplified by PCRusing primers 5¢-GGgaattcGTTTAGGACCGGGAACGAGAGC (added EcoRI site in lower case) and 5¢-gcctcgagCTTGTCTTTGTACCCAACAAC (with XhoI site) and cloned into pCGFP2 ... 5¢-noncoding sequence (GenBankaccession number NM053262) was obtained by PCR usingprimers 5¢-GGgaattcGTTTAGGACCGGGAACGAGAGC(added EcoRI site in lower case) and 5¢-GGCctcgagTCAATCGGCTTTCAGGGAACC...
- 11
- 497
- 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... dissociation rateconstant at an insignificant change in the associationrate constant (Fig. 4, D2 and D1, respectively). Also,at pH 8.5, the rebinding study reveals an increase in the association and ... courses for O2rebinding are shown in Figs 1 and 2. The transient absorption decays were analyzedusing a standard least-squares technique using home-made software for PC. After kinetic normalization,analysis ... Khan I, Juczszak L, Wang J,Manjula B, Acharya SA, Bonaventura C & Friedman JM(2004) Domain-specific effector interactions within thecentral cavity of human adult hemoglobin in solution and in...
- 11
- 577
- 0
Báo cáo khoa học: "The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs" ppt
... Primer-F: AGCTCTGGGAAACTGAATGACTTCMGB Probe: AATTCCGGTAGATAATCTPrimer-R: TGATGAGTTCACTGATGGCTTTGX53085TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAGMGB Probe: TGTAGCCAATGTCAAAGCPrimer-R: GGCATTGGCATACCCACTCTM29079X54859β-actin ... albumin, globulin, γ-glutamyltransferase (GGT), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) by automatic clinical chemistry analyzer (Cobus- Mira-Plus; Roche Diagnostic ... parametersTreatments Control ToxinTotal protein, g/lAlbumin, g/lGlobulin, g/lAlbumin/Globulinγ-Glutamyltransferase, U/lAlanine aminotransferase, U/lAspartate aminotransferase, U/lAspartate aminotransferase/Alanine...
- 6
- 179
- 0
báo cáo khoa học: " Silver nanoparticles inhibit VEGF-and IL-1 -induced vascular permeability via Src dependent pathway in porcine retinal endothelial cells" potx
... Jongsun Park3 and Sangiliyandi Gurunathan*1Address: 1Department of Biotechnology, Division of Molecular and Cellular Biology, Kalasalingam University (Kalasalingam Academy of Research and ... financial support. SG, SS, KK and DV were involved with the design, interpretation and dataanalysis. All authors read and approved the final manu-script.AcknowledgementsProf. G. Sangiliyandi ... IL-1 -induced vascular permeability via Src dependent pathway in porcine retinal endothelial cellsSardarpasha Sheikpranbabu†1, Kalimuthu Kalishwaralal†1, Deepak Venkataraman1, Soo Hyun...
- 12
- 186
- 0
Báo cáo y học: "Improving outcomes for ill and injured children in emergency departments: protocol for a program in pediatric emergency medicine and knowledge translation science" doc
... studies; train and mentor students, fel-lows, and new researchers in order to increase clinician and researcher capacity; and develop and advance a research agenda for methodological issues that arise ... physician remind-ers to increase influenza and pneumococcal vaccinationrates: A randomized trial. JAMA 2004, 292(19):2366-2371.18. Graham ID, Logan J: Innovations in knowledge transfer and continuity ... investigatorswill interview clinicians using both focus group and indi-vidual interviews in all 12 hospitals before and afterimplementation of each pathway. Data analysis will beguided by the Ottawa Model...
- 7
- 369
- 0
Tài liệu Báo cáo khoa học: "Improving Automatic Speech Recognition for Lectures through Transformation-based Rules Learned from Minimal Data" ppt
... avail-able data that would be the best candidate for ASRadaptation or training (Riccardi and Hakkani-Tur,2005; Huo and Li, 2007).1Even with all of these,however, there remains a significant gap ... Peters and Drexel(2004) address this problem by using an heuris-tic approximation to WER instead, and it appearsthat their approximation is indeed adequate whenlarge amounts of training data are ... function that ranks rules is the maincomponent of any TBL algorithm. Assuming a relatively small size for the available training data, a TBL scoring function that directly correlateswith WER can be...
- 9
- 427
- 0
Tài liệu Báo cáo khoa học: "Improving the Scalability of Semi-Markov Conditional Random Fields for Named Entity Recognition" pdf
... abstracts. We divided theoriginal training set into 1800 abstracts and 200abstracts, and the former was used as the trainingdata and the latter as the development data. For semi-CRFs, we used amis3 for ... performance. In this experiment, we couldnot examine the performance without filtering us-ing all the training data, because training on allthe training data without filtering required muchlarger ... determine the structure for propagating non-local information in advance. In a recent study by Finkel et al., (2005), non-local information is encoded using an indepen-dence model, and the inference...
- 8
- 527
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI