báo cáo khoa học: " Improving outcomes for ill and injured children in emergency departments: protocol for a program in pediatric emergency medicine and knowledge translation science" potx

... Ottawa, Ottawa, Canada, 4 Department of Pediatrics, Faculty of Medicine, University of Calgary, Calgary, Canada, 5 Departments of Pediatric and Emergency Medicine, University of Ottawa, Ottawa, ... jbrehaut@ohri.ca; Ian D Graham - igraham@cihr-irsc.gc.ca; Gillian Currie - currie@ucalgary.ca; Nicola Shaw - nicola.shaw@capitalhealth.ca; Maala Bhatt - maala.bhatt@muhc.mcgill.ca; Ti...

Ngày tải lên: 11/08/2014, 16:20

... pharmaceu- tical market share. There are about 30 pharmaceutical manufacturing facilities in Ghana and about 17–18 pro- duce all year round. Most raw materials needed for local manufacture are ... regulations relating to drug access issues in Ghana and internationally), interviews with key stakeholders and informants to identify major gaps in drug access in Ghana, and inputs...

Ngày tải lên: 11/08/2014, 18:20

... the operation a combination of 0.5 ml triamci- nolonacetonid and scandicain 2 % was intralesionally injected. The custom made silicon splint was applied directly after surgery and steroid injection ... Boorboor 3 , Benno Mann 1 , Peter Altmeyer 4 , Klaus Hoffmann 4 and Falk G Bechara 4 Address: 1 Department of General and Visceral Surgery, Augusta Kranken Anstalt, Academic Teachi...

Ngày tải lên: 11/08/2014, 23:22

... pCMVtag 5A. To obtain an expression plasmid for 17b-HSD11 with a Halo-tag at the C-terminus, a DNA fragment was amplified by PCR with primers 5¢-AAAgctagcGTTTAGGACCGGGAAC (added Nhe site in lower case) ... C-terminus, a DNA fragment was amplified by PCR using primers 5¢-GGgaattcGTTTAGGACCGGGAACGA GAGC (added EcoRI site in lower case) and 5¢-gcct cgagCTTGTCTTTGTACCCAACAAC (with Xho...

Ngày tải lên: 07/03/2014, 05:20

... dissociation rate constant at an insignificant change in the association rate constant (Fig. 4, D2 and D1, respectively). Also, at pH 8.5, the rebinding study reveals an increase in the association and ... courses for O 2 rebinding are shown in Figs 1 and 2. The transient absorption decays were analyzed using a standard least-squares technique using home- made software for PC...

Ngày tải lên: 16/03/2014, 14:20

... Primer-F: AGCTCTGGGAAACTGAATGACTTC MGB Probe: AATTCCGGTAGATAATCT Primer-R: TGATGAGTTCACTGATGGCTTTG X53085 TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAG MGB Probe: TGTAGCCAATGTCAAAGC Primer-R: GGCATTGGCATACCCACTCT M29079 X54859 β-actin ... albumin, globulin, γ-glutamyltransferase (GGT), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) by automatic clinical chemistry analyz...

Ngày tải lên: 07/08/2014, 20:23

... Jongsun Park 3 and Sangiliyandi Gurunathan* 1 Address: 1 Department of Biotechnology, Division of Molecular and Cellular Biology, Kalasalingam University (Kalasalingam Academy of Research and ... financial support. SG, SS, KK and DV were involved with the design, interpretation and data analysis. All authors read and approved the final manu- script. Acknowledgements Prof. G. Sa...

Ngày tải lên: 11/08/2014, 00:22

... studies; train and mentor students, fel- lows, and new researchers in order to increase clinician and researcher capacity; and develop and advance a research agenda for methodological issues that arise ... physician remind- ers to increase influenza and pneumococcal vaccination rates: A randomized trial. JAMA 2004, 292(19):2366-2371. 18. Graham ID, Logan J: Innovations in...

Ngày tải lên: 11/08/2014, 05:21

... avail- able data that would be the best candidate for ASR adaptation or training (Riccardi and Hakkani-Tur, 2005; Huo and Li, 2007). 1 Even with all of these, however, there remains a significant gap ... Peters and Drexel (2004) address this problem by using an heuris- tic approximation to WER instead, and it appears that their approximation is indeed adequate when large amounts of...

Ngày tải lên: 20/02/2014, 07:20

... abstracts. We divided the original training set into 1800 abstracts and 200 abstracts, and the former was used as the training data and the latter as the development data. For semi-CRFs, we used amis 3 for ... performance. In this experiment, we could not examine the performance without filtering us- ing all the training data, because training on all the training data without filter...

Ngày tải lên: 20/02/2014, 12:20