Báo cáo y học: " The impact of mental illness on potentially preventable hospitalisations: a population-based cohort stu" ppt

... (univariate analysis) and adjusted (multivariate analysis) rate ratios of total potentially preventable hospitalisations (PPHs) from negative binomial regression analysis, stratified by category of mental ... 11:163 http://www.biomedcentral.com/1471-244X/11/163 Page 3 of 11 RESEARCH ARTICLE Open Access The impact of mental illness on potentially preventable hospit...

Ngày tải lên: 11/08/2014, 16:20

... and the type of arthritis [1]. PsA typically includes psoriatic skin lesions and has a sim- ANCOVA = analysis of covariance; AS = ankylosing spondylitis; ASSERT = Ankylosing Spondylitis Study ... were eligible for the ASSERT study if they had a Bath Ankylosing Spondylitis Disease Activity Index score of ≥4 (range 0 to 10) and a spinal pain assessment score of ≥4 on a vis...

Ngày tải lên: 09/08/2014, 10:21

... K-P, Faraone SV, Nguyen TT, et al: Meta-analysis of genome-wide association studies of attention-deficit/hyperactivity disorder. Journal of the American Academy of Child & Adolescent Psychiatry ... section of the PACS in probands and siblings. The dimensional measures of all Conners’ scales, the scales of the SDQ and the SCQ, and the IQ measures are described a...

Ngày tải lên: 11/08/2014, 15:22

... not only offer better conditions for statistical analyses by the increase in sample size, but may also increase the heterogeneity in the behavioural data counteracting the gain of statisti- cal ... Developmental and Psychiatry Centre, Institute of Psychiatry, London, UK. 4 Department of Child and Adolescent Psychiatry and Psychotherapy, Central Institute of Mental Health, J...

Ngày tải lên: 11/08/2014, 15:22

... 8 statistical analysis. HA, JY, AK and ET have made contributions to acquisition and analysis of data. All authors read and approved the final manuscript. Competing interests The authors declare that they ... female/male ratio of the respondents was greater than 2:1. The overall average age was early forties; the mean age was higher for female respondents than male. The mean d...

Ngày tải lên: 11/08/2014, 16:23

... ACTAGCAACTGGACATAAGAGTACACTACC ATTACATATGGTGTCTGGAAGCCAG 60 Adam 26 CCTTGAACAACGCCCTTTTGTG GCAAGCTCCCAAAACAGGTGT 60 Loc4 TAAGGTAGGCAGTGAGAGACATCCA GGTGTAAGAAGGTTAGAACTAA 60 X141 GGGTCATAAAACGCTTTTCCAGGAA TAGCACTGGAGATCAGATTGACGCCT ... CGGTAGCAAGACATTAAAGTTCCGTA 55 Math1 CCCTCACTCAGGTCGCCTG CGTGCGAGGAGCCAATCA 55 Sox1 ACAAGAGGAGGCAGCGAACC TCGCAGGTGGAAAGTTTCTCC 55 Msx1 ACAGAAAGAAATAGCACAGACCATAA...

Ngày tải lên: 14/08/2014, 08:20

... Obtaining data on specific inflammatory markers that may play a role in the differences in response to an infectious insult may clarify the association as well. Hyperglycaemia may be another factor ... Metab 2001, 86:3250-3256. 30. Ghanim H, Garg R, Aljada A, Mohanty P, Kumbkarni Y, Assian E, Hamouda W, Dandona P: Suppression of nuclear factor-kap- paB and stimulation of inhibit...

Ngày tải lên: 13/08/2014, 15:21

... years before and after of the initiation of NARP in 2003. The study in- cluded the data obtained from all of the four univer- sity hospitals, and one referral tertiary-care educa- tional state ... February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11]. This is a quasi-experimental study p...

Ngày tải lên: 25/10/2012, 11:00

... Mombasa, Kenya and 4 Kakamega Provincial General Hospital, Kakamega, Kenya Email: David M Ndetei* - dmndetei@uonbi.ac.ke; Lincoln I Khasakhala - likhasakhala@yahoo.com; Mary W Kuria - wangari2@yahoo.com; ... recog- nised. The possibility that a significant proportion of the patients attending a general health facility may have a mental disorder means that psychiatric conditions...

Ngày tải lên: 08/08/2014, 23:21

... RA. Disease duration and age at RA onset was similar in cases and controls (mean 11.3 years versus 12.5 years for duration, and mean 50.1 years versus 50.4 years for age at RA onset; Table 1). There ... classified as DRB1*04 non-SE alleles. Statistical analysis The age at RA diagnosis and the duration of RA at inclusion in ExRA cases and non-ExRA controls with RA were compared using th...

Ngày tải lên: 09/08/2014, 07:20