Báo cáo y học: " The impact of mental illness on potentially preventable hospitalisations: a population-based cohort stu" ppt
Báo cáo y học: " The impact of mental illness on potentially preventable hospitalisations: a population-based cohort stu" ppt
... (univariate analysis) and adjusted (multivariate analysis) rate ratios of total potentially preventable
hospitalisations (PPHs) from negative binomial regression analysis, stratified by category of mental ... 11:163
http://www.biomedcentral.com/1471-244X/11/163
Page 3 of 11
RESEARCH ARTICLE Open Access
The impact of mental illness on potentially
preventable hospit...
Báo cáo y học: "The impact of infliximab treatment on quality of life in patients with inflammatory rheumatic diseases" ppsx
... and the type of arthritis
[1]. PsA typically includes psoriatic skin lesions and has a sim-
ANCOVA = analysis of covariance; AS = ankylosing spondylitis; ASSERT = Ankylosing Spondylitis Study ... were
eligible for the ASSERT study if they had a Bath Ankylosing
Spondylitis Disease Activity Index score of ≥4 (range 0 to 10)
and a spinal pain assessment score of ≥4 on a vis...
Báo cáo y học: "The impact of study design and diagnostic approach in a large multi-centre ADHD study. Part 1: ADHD symptom patterns" ppsx
... K-P,
Faraone SV, Nguyen TT, et al: Meta-analysis of genome-wide association
studies of attention-deficit/hyperactivity disorder. Journal of the American
Academy of Child & Adolescent Psychiatry ... section of the
PACS in probands and siblings.
The dimensional measures of all Conners’ scales, the
scales of the SDQ and the SCQ, and the IQ measures
are described a...
Báo cáo y học: "The impact of study design and diagnostic approach in a large multi-centre ADHD study: Part 2: Dimensional measures of psychopathology and intelligence" pptx
... not only offer
better conditions for statistical analyses by the increase
in sample size, but may also increase the heterogeneity
in the behavioural data counteracting the gain of statisti-
cal ... Developmental
and Psychiatry Centre, Institute of Psychiatry, London, UK.
4
Department of
Child and Adolescent Psychiatry and Psychotherapy, Central Institute of
Mental Health, J...
Báo cáo y học: " The impact of inpatient suicide on psychiatric nurses and their need for support" pdf
... 8
statistical analysis. HA, JY, AK and ET have made contributions to acquisition
and analysis of data. All authors read and approved the final manuscript.
Competing interests
The authors declare that they ... female/male ratio of the respondents was greater
than 2:1. The overall average age was early forties; the
mean age was higher for female respondents than male.
The mean d...
Báo cáo y học: "The impact of chromatin modifiers on the timing of locus replication in mouse embryonic stem cells" pot
... ACTAGCAACTGGACATAAGAGTACACTACC ATTACATATGGTGTCTGGAAGCCAG 60
Adam 26 CCTTGAACAACGCCCTTTTGTG GCAAGCTCCCAAAACAGGTGT 60
Loc4 TAAGGTAGGCAGTGAGAGACATCCA GGTGTAAGAAGGTTAGAACTAA 60
X141 GGGTCATAAAACGCTTTTCCAGGAA TAGCACTGGAGATCAGATTGACGCCT ... CGGTAGCAAGACATTAAAGTTCCGTA 55
Math1 CCCTCACTCAGGTCGCCTG CGTGCGAGGAGCCAATCA 55
Sox1 ACAAGAGGAGGCAGCGAACC TCGCAGGTGGAAAGTTTCTCC 55
Msx1 ACAGAAAGAAATAGCACAGACCATAA...
Báo cáo y học: "The effect of diabetes mellitus on organ dysfunction with sepsis: an epidemiological study" pptx
... Obtaining data on specific inflammatory
markers that may play a role in the differences in response to
an infectious insult may clarify the association as well.
Hyperglycaemia may be another factor ... Metab 2001, 86:3250-3256.
30. Ghanim H, Garg R, Aljada A, Mohanty P, Kumbkarni Y, Assian E,
Hamouda W, Dandona P: Suppression of nuclear factor-kap-
paB and stimulation of inhibit...
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... years before and
after of the initiation of NARP in 2003. The study in-
cluded the data obtained from all of the four univer-
sity hospitals, and one referral tertiary-care educa-
tional state ... February 2003 by a central
regulation of Ministry of Health and was announced
nation-wide via official newspaper of the state [11].
This is a quasi-experimental study p...
Báo cáo y học: "The prevalence of mental disorders in adults in different level general medical facilities in Kenya: a cross-sectional study" pot
... Mombasa, Kenya and
4
Kakamega Provincial General Hospital, Kakamega, Kenya
Email: David M Ndetei* - dmndetei@uonbi.ac.ke; Lincoln I Khasakhala - likhasakhala@yahoo.com; Mary W Kuria - wangari2@yahoo.com; ... recog-
nised.
The possibility that a significant proportion of the
patients attending a general health facility may have a
mental disorder means that psychiatric conditions...
Báo cáo y học: "The impact of HLA-DRB1 genes on extra-articular disease manifestations in rheumatoid arthritis" doc
... RA.
Disease duration and age at RA onset was similar in cases and
controls (mean 11.3 years versus 12.5 years for duration, and
mean 50.1 years versus 50.4 years for age at RA onset; Table
1). There ... classified as DRB1*04 non-SE
alleles.
Statistical analysis
The age at RA diagnosis and the duration of RA at inclusion in
ExRA cases and non-ExRA controls with RA were compared
using th...
Từ khóa:
- báo cáo y học
- báo cáo y học cổ truyền
- mẫu báo cáo y học cổ truyền
- bao cao y hoc colchicin
- phan ban luan trong bao cao y hoc co truyen
- the impact of environmental pollution on congenital anomalies
- the impact of environmental pollution on human beings
- the impact of environmental pollution on human health
- what is the impact of soil salinity on agriculture