Báo cáo y học: "Early response predicts subsequent response to olanzapine long-acting injection in a randomized, double-blind clinical trial of treatment for schizophrenia" potx

Báo cáo y học: "The relaxation exercise and social support trialresst: study protocol for a randomized community based trial" potx

Báo cáo y học: "The relaxation exercise and social support trialresst: study protocol for a randomized community based trial" potx

... also affect health-seek- ing behaviour, leading often to unnecessary spending on health care and ineffective management [8,9]. In fact, the syndromic management of vaginal discharge can lead to inappropriate ... burden of families of patients with schizophrenia in Italy. Acta Physchiatrica Scandainvaica 2002, 106(4):291-298. 39. Sumathipala A, Hewege S, Hanwella R, Mann AH: Ran...

Ngày tải lên: 11/08/2014, 15:22

8 569 0
báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps

báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps

... analysis of variance tests were conducted to examine differences in participants’ satisfaction, self-efficacy, and mental effort as a function of training intervention. A series of analysis of variance ... one-way analysis of variance tests were sub- sequently calculated to examine differences in distance function as a function of training intervention. Second, perfo...

Ngày tải lên: 10/08/2014, 11:20

10 439 0
Báo cáo y học: "Early and late morbidity and mortality and life expectancy following thoracoscopic talc insufflation for control of malignant pleural effusions: a review of 400 cases" potx

Báo cáo y học: "Early and late morbidity and mortality and life expectancy following thoracoscopic talc insufflation for control of malignant pleural effusions: a review of 400 cases" potx

... magnesium sheet silicate. Preparations historically have had some minimal associated impurities, most notably asbestos. Talc can be used during thoracoscopy or thoracotomy, or as a slurry via ... Tetracy- cline the agent used most commonly in the past, is no longer commercially available. Many other chemothera- peutic agents such as doxorubicin, cisplatin and cytara- bine combination, eto...

Ngày tải lên: 10/08/2014, 09:22

7 347 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

... transfection reagent (Neuromics, Edina, MN, USA) was administered intrathecally once daily for 7 days, starting from 1 day before CCI surgery. Evaluation of tactile allodynia and thermal hyperalgesia ... C., Gaykema R.P., Holguin A. , Martin D., Maier S.F., Watkins L.R. Intrathecal HIV-1 envelope glycoprotein gp120 induces enhanced pain states mediated by spinal cord proin- flammat...

Ngày tải lên: 25/10/2012, 11:48

9 487 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... Guanosine diphosphate-4-keto-6-deoxy- D -mannose reductase in the pathway for the synthesis of GDP-6-deoxy- D -talose in Actinobacillus actinomycetemcomitans Nao Suzuki 1 , Yoshio Nakano 1 , Yasuo ... designed to introduce appropriate restriction sites for subcloning: to subclone the gmd gene into the vector pIVEX2.3, 5¢-CGCG CCATGGTGAAAACAGCAATTGTAACT-3¢ (NcoI) and 5¢-GCGCCCCGG...

Ngày tải lên: 17/03/2014, 10:20

9 626 0
Báo cáo y học: "The PI3K–NF-κB signal transduction pathway is involved in mediating the anti-inflammatory effect of IB-MECA in adjuvant-induced arthritis" pdf

Báo cáo y học: "The PI3K–NF-κB signal transduction pathway is involved in mediating the anti-inflammatory effect of IB-MECA in adjuvant-induced arthritis" pdf

... pathway takes place, resulting in amelioration of the inflammatory process. Materials and methods Reagents The A 3 AR agonist IB-MECA was synthesized for Can-Fite BioPharma by Albany Molecular ... proteins [18]. Apoptotic pathways are also known to be controlled downstream to PKB/Akt. Caspase-9 and caspase 3, which are downregulated upon PKB/Akt activation, fail to activate path...

Ngày tải lên: 09/08/2014, 07:20

9 373 0
Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx

Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx

... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteo- clastogenesis by ectodomain shedding of receptor activator of NF-kappa ... GAPDH, forward: ACCCAGAAGACTGTGGATGG; GAPDH, reverse: CAGTGAGCTTCCCGTTCAG; OPG, for- ward: CTGTTTTCACAGAGGTCAATATCTT; OPG, reverse: GCTCACAAGAACAGACTTTCCAG; and RANKL, forward: CCAAGATC...

Ngày tải lên: 09/08/2014, 10:22

9 410 0
Báo cáo y học: " Factors associated with late presentation to HIV/AIDS care in South Wollo ZoneEthiopia: a case-control study" pps

Báo cáo y học: " Factors associated with late presentation to HIV/AIDS care in South Wollo ZoneEthiopia: a case-control study" pps

... M, Mazimba A, Seidenberg P, et al: Barriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a cross- sectional study of cost, stigma, and perceptions about ART. ... and health workers allowed a cross-validation of data and possibly a minimization of biases. Using case-control study design for assessing factors associated with late presen-...

Ngày tải lên: 10/08/2014, 05:22

6 381 0
Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf

Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf

... months postpartum on a cardiac biventricular assist device (BVAD) as bridge to heart transplantation with delayed onset of intracardial shunting and subsequent hypoxemia due to massive pulmonary embolism. ... has an incidence up to 27% in normal healthy a dults as well as in adult cardiac surgical p atients [8,9]. If left ventricular as sist device (LVAD) is activated, left...

Ngày tải lên: 10/08/2014, 09:22

4 379 0
Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps

Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps

... diseases. RTA is a medical condition that involves an accumulation of acid in the body due to a failure of the kidneys to appropriately acidify the urine [1]. Table 1 Laboratory investigations ... left base were noted on the respiratory system examination. The cardiovascular and neurological examinations were unremarkable. Initial laboratory investigations (Table 1) revealed ane...

Ngày tải lên: 11/08/2014, 00:23

5 509 0
Từ khóa:
w