Báo cáo y học: "Early response predicts subsequent response to olanzapine long-acting injection in a randomized, double-blind clinical trial of treatment for schizophrenia" potx
Báo cáo y học: "The relaxation exercise and social support trialresst: study protocol for a randomized community based trial" potx
... also affect health-seek-ing behaviour, leading often to unnecessary spending onhealth care and ineffective management [8,9]. In fact,the syndromic management of vaginal discharge canlead to inappropriate ... burden of families of patients with schizophrenia in Italy. ActaPhyschiatrica Scandainvaica 2002, 106(4):291-298.39. Sumathipala A, Hewege S, Hanwella R, Mann AH: Randomizedcontrolled trial of ... imagery canalleviate depressive symptoms by enhancing self efficacyand decreasing persistent unexplained physical symp-toms [43-47].We conducted a community-based randomized trial, comparing...
- 8
- 569
- 0
báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps
... analysis of variance tests were conducted to examine differences in participants’ satisfaction, self-efficacy, and mental effort as a function of training intervention. A series of analysis of variance ... one-way analysis of variance tests were sub-sequently calculated to examine differences in distancefunction as a function of training intervention.Second, performance was measured by examining ... respectively (p >0.05forallcomparisons).Mental effort (Table 4)Themultivariateanalysisofvariancefailedtoshowadifference in pa rticipants’ reporting of mental effort as a function of training...
- 10
- 438
- 0
Báo cáo y học: "Early and late morbidity and mortality and life expectancy following thoracoscopic talc insufflation for control of malignant pleural effusions: a review of 400 cases" potx
... magnesiumsheet silicate. Preparations historically have had someminimal associated impurities, most notably asbestos.Talc can be used during thoracoscopy or thoracotomy, oras a slurry via ... Tetracy-cline the agent used most commonly in the past, is nolonger commercially available. Many other chemothera-peutic agents such as doxorubicin, cisplatin and cytara-bine combination, etoposide, ... pleural catheter drain-age has established itself as a less expensive, minimallyinvasive, and palliative modality for the management of malignant pleural effusions. Dozens of recent publica-tions...
- 7
- 347
- 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... transfection reagent (Neuromics, Edina, MN, USA) was administered intrathecally once daily for 7 days, starting from 1 day before CCI surgery. Evaluation of tactile allodynia and thermal hyperalgesia ... C., Gaykema R.P., Holguin A. , Martin D., Maier S.F., Watkins L.R. Intrathecal HIV-1 envelope glycoprotein gp120 induces enhanced pain states mediated by spinal cord proin-flammatory cytokines. ... hyperalgesia The paw withdrawal latency (PWL) to radiant heat and paw withdrawal threshold (PWT) were used to evaluate thermal hyperalgesia and mechanical al-lodynia respectively as previously...
- 9
- 487
- 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitansNao Suzuki1, Yoshio Nakano1, Yasuo ... designed to introduceappropriate restriction sites for subcloning: to subclonethe gmd gene into the vector pIVEX2.3, 5¢-CGCGCCATGGTGAAAACAGCAATTGTAACT-3¢ (NcoI)and 5¢-GCGCCCCGGGAAAAGAAAAACC-3¢ ... possible that feedback inhibition of theGDP -a- D-mannose 4,6-dehydratase occurs via the GDP-6-deoxy-D-talose pathway in A. actinomycetemcomitansSUNYaB 75. In the enzyme assay using the purifiedHis6-tagged...
- 9
- 625
- 0
Báo cáo y học: "The PI3K–NF-κB signal transduction pathway is involved in mediating the anti-inflammatory effect of IB-MECA in adjuvant-induced arthritis" pdf
... pathway takes place,resulting in amelioration of the inflammatory process.Materials and methodsReagentsThe A 3AR agonist IB-MECA was synthesized for Can-FiteBioPharma by Albany Molecular ... proteins[18]. Apoptotic pathways are also known to be controlleddownstream to PKB/Akt. Caspase-9 and caspase 3, whichare downregulated upon PKB/Akt activation, fail to activatepathways leading to apoptosis ... response [13].The A 3AR belongs to the family of the Gi-protein-associatedcell membrane receptors. Receptor activation leads to inhibi-tion of adenylyl cyclase activity, inhibition of cAMP formationand inhibition...
- 9
- 373
- 0
Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx
... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteo-clastogenesis by ectodomain shedding of receptor activator of NF-kappa ... GAPDH, forward: ACCCAGAAGACTGTGGATGG;GAPDH, reverse: CAGTGAGCTTCCCGTTCAG; OPG, for- ward: CTGTTTTCACAGAGGTCAATATCTT; OPG, reverse:GCTCACAAGAACAGACTTTCCAG; and RANKL, forward:CCAAGATCTCCAACATGACT; ... osteoblast-likecells by activating TNF-alpha converting enzyme (TACE). JBone Miner Res 2004, 19:147-154.41. Nakamichi Y, Udagawa N, Kobayashi Y, Nakamura M, Yamamoto Y, Yamashita T, Mizoguchi T, Sato M, Mogi...
- 9
- 410
- 0
Báo cáo y học: " Factors associated with late presentation to HIV/AIDS care in South Wollo ZoneEthiopia: a case-control study" pps
... M, Mazimba A, Seidenberg P, et al: Barriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a cross-sectional study of cost, stigma, and perceptions about ART. ... and healthworkers allowed a cross-validation of data and possibly a minimization of biases. Using case-control studydesign for assessing factors associated with late presen-tation to HIV/AIDS ... therapy programs depends on early initiation of HIV/AIDs care. The purpose of thestudy was to examine factors associated with late presentation to HIV/AIDS care.Methods: A case-control study was...
- 6
- 381
- 0
Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf
... monthspostpartum on a cardiac biventricular assist device (BVAD) as bridge to heart transplantation with delayed onset of intracardial shunting and subsequent hypoxemia due to massive pulmonary embolism. ... has an incidenceup to 27% in normal healthy a dults as well as in adultcardiac surgical p atients [8,9]. If left ventricular as sistdevice (LVAD) is activated, left atrial unloading leads to a ... bypass and after LVAD activation [12,13]. Alter-natively, manual occlusion of the pulmonary arteryshortly before activatio n of the LVAD by the surgeonand transesophageal echocardiography studies...
- 4
- 379
- 0
Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps
... diseases. RTA is a medical condition that involves an accumulation of acid in the body due to a failure of the kidneys to appropriatelyacidify the urine [1].Table 1 Laboratory investigations ... left base were noted on therespiratory system examination. The cardiovascular andneurological examinations were unremarkable.Initial laboratory investigations (Table 1) revealed ane-mia, leukopenia, ... examination revealed an ill-looking womanwith mucosal pallor, generalized w asting and non-tender, rubbery axillary and inguinal lymphadenopathy.There was no evidence of cyanosis, digital clubbing,...
- 5
- 509
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP