Báo cáo y học: " Communication patterns in a psychotherapy following traumatic brain injury: A quantitative case study based on symbolic dynamics" pptx
Báo cáo y học: " Communication patterns in a psychotherapy following traumatic brain injury: A quantitative case study based on symbolic dynamics" pptx
... 11:119 http://www.biomedcentral.com/1471-244X/11/119 Page 4 of 28 RESEARC H ARTIC LE Open Access Communication patterns in a psychotherapy following traumatic brain injury: A quantitative case study based on symbolic dynamics Paul E Rapp 1* , Christopher ... traumatic brain injury. Brain Injury 1996, 10:319-327. 7. Ashman TA, Spielman SA, Hibbard MR, Silv...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Autoantibody profile in systemic lupus erythematosus with psychiatric manifestations: a role for anti-endothelial-cell antibodies" docx
... 41:1357-1366. 51. Yoshio T, Masuyama J, Ikeda M, Tamai K, Hachiya T, Emori T, Mimori A, Takeda A, Minota S, Kano S: Quantification of antiri- bosomal P0 protein antibodies by ELISA with recombinant P0 fusion ... Smith TA, Panayiotou A, Staines NA, Murphy JJ: Identification of candi- date endothelial cell autoantigens in systemic lupus ery- thematosus using a molecular cloning strategy:...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Neuropsychological patterns in systemic lupus erythematosus patients with depression" potx
... Diagnostic Aphasia Examination-Complex Ideational Material Test; PASAT: Paced Auditory Serial Addition Test; Story learning: Learning component of Story Memory Test; Story recall: Delayed component ... pro- vides a qualitative and quantitative assessment of pain. It con- tains 15 pain-related words divided into sensory and affective categories in a pain-rating index. Individuals are...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Metaplastic ossification in the cartilage of the bronchus of a patient with chronic multi-drug resistant tuberculosis: a case report" potx
... streptomycin. Among second-line agents this strain was also found to be resistant to prothionamide, para-aminosalicylic acid, and ofloxacin. The isolate retained sensitivity to kanamy- cin, capreomycin, ... bony metaplasia was found in the cartilage of his bronchial wall. Histopathological examination confirmed calcification and showed hematopoietic cells forming in his marrow cavity. C...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "Congenital hydrocephalus in an Egyptian baby with trisomy 18: a case report" pptx
... hydrocephalus in an Egyptian baby with trisomy 18: a case report Kotb A Metwalley 1 , Hekma S Farghalley 2 and Alaa A Abd-Elsayed* 3 Address: 1 Department of Pediatrics, Faculty of Medicine, Assiut ... Egypt Email: Kotb A Metwalley - kotb72@hotmail.com; Hekma S Farghalley - hekma73@hotmail.com; Alaa A Abd- Elsayed* - alaaawny@hotmail.com * Corresponding author Abstract Intro...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: "Antithrombin III in patients admitted to intensive care units: a multicenter observational study" doc
... intravascular coagulation. In conclusion, our findings based on an observational prospective study and on an updated meta-analysis of the previous RCTs do not support the use of this drug in ICU patients ... observational study Andrea Messori 1 , Franca Vacca 2 , Monica Vaiani 2 , Sabrina Trippoli 2 , and the Gruppo di Studio sull’antitrombina III* 1 Coordinator, Laboratorio SIF...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc
... O, Andersson S, da Silva Z, Hedegaard K, Sandstrom A, Naucler A, Dias F, Melbye M, Aaby P: Prevalences of HTLV-1 infection and associated risk determinants in an urban population in Guinea-Bissau, ... van der Loeff MF, Awasana AA, Sarge-Njie R, van der Sande M, Jaye A, Sabally S, Corrah T, McConkey SJ, Whittle HC: Sixteen years of HIV surveillance in a West African research clin...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Percutaneous tracheostomy in patients with severe liver disease and a high incidence of refractory coagulopathy: a prospective trial" doc
... clinically obvious barotrauma complications in the study patients, apart from one incidence of temporary subcutaneous emphysema. The overall ICU and hospital mortality in this study might appear ... the inter- vention and maintained until reversal of paralysis. Continuous heart rate monitoring, arterial oxygen saturation measurement, end tidal CO 2 , and invasive arterial blood pressu...
Ngày tải lên: 13/08/2014, 08:20
Báo cáo y học: " SIVdrl detection in captive mandrills: are mandrills infected with a third strain of simian immunodeficiency virus?" potx
... evolution and distribution of SIV strains in African primate species [1]. SIV cross-species transmissions are ongoing, and Afri- can green monkey strains have recently been detected in patas monkeys ... primer SIVmnd1C AGATTATAGACCCTATACTGC 5'second primer C-D* = 282 nt SIVmnd1D CATCCAATGAAAGGGAGGTTC 3' second primer SIVmnd 2A GGACATAGGGGATGCCTATT 5' first primer A- B = 3...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Pharmacotherapeutic intervention in impulsive preschool children: The need for a comprehensive therapeutic approach" pptx
... of emotion r egulation plays a key role, only multi-psycho- social interventions show consistently sustainable effects [19-21]. Parenting that is provided in infancy and early childhood plays a crucial ... maltreatment. Main targets of intervention: The impact of early environmental conditions It was repeatedly shown that an early adverse rearing environment is associated with altered f...
Ngày tải lên: 13/08/2014, 18:21