Báo cáo y học: " Communication patterns in a psychotherapy following traumatic brain injury: A quantitative case study based on symbolic dynamics" pptx
Báo cáo y học: " Communication patterns in a psychotherapy following traumatic brain injury: A quantitative case study based on symbolic dynamics" pptx
... 11:119
http://www.biomedcentral.com/1471-244X/11/119
Page 4 of 28
RESEARC H ARTIC LE Open Access
Communication patterns in a psychotherapy
following traumatic brain injury: A quantitative
case study based on symbolic dynamics
Paul E Rapp
1*
, Christopher ... traumatic brain injury. Brain Injury 1996, 10:319-327.
7. Ashman TA, Spielman SA, Hibbard MR, Silv...
Báo cáo y học: "Autoantibody profile in systemic lupus erythematosus with psychiatric manifestations: a role for anti-endothelial-cell antibodies" docx
... 41:1357-1366.
51. Yoshio T, Masuyama J, Ikeda M, Tamai K, Hachiya T, Emori T,
Mimori A, Takeda A, Minota S, Kano S: Quantification of antiri-
bosomal P0 protein antibodies by ELISA with recombinant P0
fusion ... Smith
TA, Panayiotou A, Staines NA, Murphy JJ: Identification of candi-
date endothelial cell autoantigens in systemic lupus ery-
thematosus using a molecular cloning strategy:...
Báo cáo y học: "Neuropsychological patterns in systemic lupus erythematosus patients with depression" potx
... Diagnostic
Aphasia Examination-Complex Ideational Material Test; PASAT: Paced Auditory Serial Addition Test; Story learning: Learning component of Story
Memory Test; Story recall: Delayed component ... pro-
vides a qualitative and quantitative assessment of pain. It con-
tains 15 pain-related words divided into sensory and affective
categories in a pain-rating index. Individuals are...
Báo cáo y học: "Metaplastic ossification in the cartilage of the bronchus of a patient with chronic multi-drug resistant tuberculosis: a case report" potx
... streptomycin.
Among second-line agents this strain was also found to
be resistant to prothionamide, para-aminosalicylic acid,
and ofloxacin. The isolate retained sensitivity to kanamy-
cin, capreomycin, ... bony
metaplasia was found in the cartilage of his bronchial wall. Histopathological examination confirmed calcification and
showed hematopoietic cells forming in his marrow cavity.
C...
Báo cáo y học: "Congenital hydrocephalus in an Egyptian baby with trisomy 18: a case report" pptx
... hydrocephalus in an Egyptian baby with trisomy
18: a case report
Kotb A Metwalley
1
, Hekma S Farghalley
2
and Alaa A Abd-Elsayed*
3
Address:
1
Department of Pediatrics, Faculty of Medicine, Assiut ... Egypt
Email: Kotb A Metwalley - kotb72@hotmail.com; Hekma S Farghalley - hekma73@hotmail.com; Alaa A Abd-
Elsayed* - alaaawny@hotmail.com
* Corresponding author
Abstract
Intro...
Báo cáo y học: "Antithrombin III in patients admitted to intensive care units: a multicenter observational study" doc
... intravascular coagulation.
In conclusion, our findings based on an observational
prospective study and on an updated meta-analysis of the
previous RCTs do not support the use of this drug in ICU
patients ... observational study
Andrea Messori
1
, Franca Vacca
2
, Monica Vaiani
2
, Sabrina Trippoli
2
, and the Gruppo di Studio
sull’antitrombina III*
1
Coordinator, Laboratorio SIF...
Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc
... O, Andersson S, da Silva Z, Hedegaard K, Sandstrom A, Naucler A,
Dias F, Melbye M, Aaby P: Prevalences of HTLV-1 infection and
associated risk determinants in an urban population in Guinea-Bissau, ... van der Loeff MF, Awasana AA, Sarge-Njie R, van der Sande M, Jaye
A, Sabally S, Corrah T, McConkey SJ, Whittle HC: Sixteen years of HIV
surveillance in a West African research clin...
Báo cáo y học: "Percutaneous tracheostomy in patients with severe liver disease and a high incidence of refractory coagulopathy: a prospective trial" doc
... clinically obvious barotrauma
complications in the study patients, apart from one incidence
of temporary subcutaneous emphysema.
The overall ICU and hospital mortality in this study might
appear ... the inter-
vention and maintained until reversal of paralysis. Continuous
heart rate monitoring, arterial oxygen saturation measurement,
end tidal CO
2
, and invasive arterial blood pressu...
Báo cáo y học: " SIVdrl detection in captive mandrills: are mandrills infected with a third strain of simian immunodeficiency virus?" potx
... evolution
and distribution of SIV strains in African primate species
[1]. SIV cross-species transmissions are ongoing, and Afri-
can green monkey strains have recently been detected in
patas monkeys ... primer
SIVmnd1C AGATTATAGACCCTATACTGC 5'second primer C-D* = 282 nt
SIVmnd1D CATCCAATGAAAGGGAGGTTC 3' second primer
SIVmnd 2A GGACATAGGGGATGCCTATT 5' first primer A- B = 3...
Báo cáo y học: "Pharmacotherapeutic intervention in impulsive preschool children: The need for a comprehensive therapeutic approach" pptx
... of
emotion r egulation plays a key role, only multi-psycho-
social interventions show consistently sustainable effects
[19-21]. Parenting that is provided in infancy and early
childhood plays a crucial ... maltreatment.
Main targets of intervention: The impact of early
environmental conditions
It was repeatedly shown that an early adverse rearing
environment is associated with altered f...