Báo cáo y học: "Onset of efficacy and tolerability following the initiation dosing of long-acting paliperidone palmitate: post-hoc analyses of a randomized, double-blind clinical trial" doc
Báo cáo y học: "Onset of efficacy and tolerability following the initiation dosing of long-acting paliperidone palmitate: post-hoc analyses of a randomized, double-blind clinical trial" doc
... 11:79 http://www.biomedcentral.com/1471-244X/11/79 Page 3 of 10 RESEARCH ARTICLE Open Access Onset of efficacy and tolerability following the initiation dosing of long-acting paliperidone palmitate: post-hoc analyses of a randomized, double-blind ... initiation dosing of long-acting paliperidone palmitate: post-hoc analyses of a rando...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand ... make a 50-bp static junc tion, J0, labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo y học: "Improvement in symptoms and signs in the forefoot of patients with rheumatoid arthritis treated with anti-TNF therapy" ppsx
... of the study, carried out the assessment of eligibility of RA patients for anti-TNF ther- apy and helped to draft the manuscript. LH participated in the data analysis and helped to draft the manuscript. ... anti-TNF therapy (infliximab, etanercept, adalimumab) were assessed for presence of synovial hypertrophy and synovitis in the 2 nd and 5 th metatarso-phalange...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: " Tumor necrosis factor and norepinephrine lower the levels of human neutrophil peptides 1-3 secretion by mixed synovial tissue cultures in osteoarthritis and rheumatoid arthritis" ppt
... RHS participated in the concept and design, analysis and interpretation of data, and drafting and revising the article. Acknowledgements The authors thank Dr. Sven Anders and Dr. Joachim Grifka ... interests. Authors' contributions BR and SG participated in the concept and design and acquisition of data. RW and MF participated in interpretation of data an...
Ngày tải lên: 12/08/2014, 14:22
Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx
... RNA is caused by a reduced association of Gag with the ΔSL1 RNA. We then examined the association between Gag and spliced HIV-1 mRNA. Compared to the wild type, we found that Gag showed an enhanced ... revertant Figure 7 Characterization of the association between Gag and HIV-1 RNA. (A) Measurementoftheassociation between Gag and HIV-1 genomic RNA. HIV-1 genomic RNA immuno...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot
... surgery. TheclinicalpracticeinSwedenandAustraliaand New Zealand seems to be similar in terms of the com- ponents of postoperative physiotherapy treatment, assessment of physiotherapy given to all ... on days 2 and 3, and typically one treatment on days 4 and 5. Physiotherapy treatment was never given during the evenings. On Saturdays, phy- siotherapy treatment was reported to...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: " Sitagliptin is effective and safe as add-on to insulin in patients with absolute insulin deficiency: a case series" potx
... efficacy of sitagliptin in three Japanese patients (a 91-year-old Japanese woman with type 1 diabetes, a 54-year-old Japanese man with type 2 diabetes and a 30-year-old Japanese man with features ... observed in the kid- ney (assessed on the basis of blood urea nitrogen and crea tinine levels) or liver (assessed by glutamate oxaloa- cetate transaminase, glutamate pyruvate t...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Life after 45 and before 60: the Retrovirology Prize" doc
... retrovirologist. The silent majority In his US presidential campaigns, Richard Nixon famously popularized the concept of a "silent majority". Fundamentally what Nixon meant was that the stalwart contributors ... come through an Editorial Board member of Retrovirology. Candidates may self-nominate, but they must ask a Retrovirology Editorial board member to communicate...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: " Long-term CD4+ lymphocyte response following HAART initiation in a U.S. Military prospective cohort" potx
... CD4+ Strata at HAART Initiation for All Par ticipants, U.S. Military HIV Natural History Study. Table 2 Average Change in CD4+ Count by Time Since HAART Initiation: All Participants and Viral Suppressors ... CD4+ strata, the greatest average increases (93-151 cells) were noted Table 1 Characteristics of Participants in U.S. Military HIV Natural History Study by Baseline CD4+ Strata a...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Two-year home-based nocturnal noninvasive ventilation added to rehabilitation in chronic obstructive pulmonary disease patients: A randomized controlled trial" pot
... with all data of all patients available at the start of the home-based period included for ana- lyses and all avail able data used for analyses until patients dropped out. A p < 0.05 was considered ... from the NIPPV + PR group andthePRgroup)visitedthe physiotherapist once a week because the distance to travel to the physiotherapy practice was too long. All participat...
Ngày tải lên: 12/08/2014, 14:20