Báo cáo y học: "Functional impairment related to painful physical symptoms in patients with generalized anxiety disorder with or without comorbid major depressive disorder: post hoc analysis of a crosssectional study" docx
... this article as: Romera et al.: Functional impairment related to painful physical symptoms in patients with generalized anxiety disorder with or without comorbid major depressive disorder: post hoc ... Polavieja 1 , Durisala Desaiah 6 and Inmaculada Gilaberte 1 Abstract Background: Generalized anxiety disorder (GAD) is the most frequent anxiety...
Ngày tải lên: 11/08/2014, 15:22
... therapeutic dosing in patients with reduced clearance of colchicine due to pre- existing renal or hepatic impairment. Acute pancreatitis has rarely been reported, and only in association with ... colchicine overdose accompanied by multi-organ failure. Case presentation: We report a case of acute pancreatitis without other organ toxicity related to recent commencemen...
Ngày tải lên: 11/08/2014, 10:23
... pre-bronchodilator FEV 1 , leave a greater space for increase following inhalation of a bronchodilator. Conclusion Uniform international standards for the diagnosis of COPD are lacking. The existing major ... Males Females Mean and 95% confidence interval AB FEV 1 (% of pred value) Post- bronchodilator Pre-bronchodilator n = 3881 Post- bronchodilator n = 1574 Respiratory Resea...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: " Endothelial Endotoxemia related to cardiopulmonary bypass is associated with increased risk of infection after cardiac surgery: a prospective observational stud" pptx
... study was to examine the prevalence of endotoxemia during cardiopulmonary bypass supported aortocoronary bypass grafting surgery (ACB) using a new assay, the Endotoxin Activity Assay (EAA), and ... collection and analysis. RN was responsible for statistical analysis and contributed to the manuscript. ADR was involved in performing the assay and data analysis, and contributed to...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "Promoter features related to tissue specificity as measured by Shannon entropy" doc
... bits. Expression Expression Expression Expression Adipose Adrenal_gland Amygdala Bladder Bone Bone_marrow Brown_fat Cerebellum Dorsal_root_ganglion Epidermis Eye Frontal_cortex Gall_bladder Heart Hippocampus Hypothalamus Kidney Large_intestine Liver Lung Lymph_node Mammary_gland Olfactory_bulb Ovary Placenta Prostate Salivary_gland Skeletal_muscle Small_intestine Spinal_cord Spleen Stomach St...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps
... TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG Fr TAGCCCACGACAGCCAAATAATAATGAATCATTTCATAAATAATGGGTTTAGGGGCTTATCGGGA Rn GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG ... TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGCGGA M m TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG Pt TCTGGTGAAATTGC...
Ngày tải lên: 14/08/2014, 16:20
Báo cáo y học: " Functional inhibition of NF-κB signal transduction in αvβ3 integrin expressing endothelial cells by using RGD-PEG-modified adenovirus with a mutant IκB gene" ppsx
... chronic inflammatory processes have been associated with elevated levels of endothelial NF- κB [9-13]. A dominant negative form of IκB (dnIκB) that contains serine- to- alanine mutations at amino acids ... Adenoviral gene deliv- ery of elafin and secretory leukocyte protease inhibitor atten- uates NF-kappa B-dependent inflammatory responses of human endothelial cells and macropha...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Transition of healthy to diseased synovial tissue in rheumatoid arthritis is associated with gain of mesenchymal/fibrotic characteristics" pdf
... 5'-CAGGCGCATGAAGGCAAGTTGGGTAG-3' α-sma 5'-CGTGTTGCCCCTGAAGAGCAT-3' 5'-ACCGCCTGGATAGCCACATACA-3' TLH 5'-TTAAAGGAAAGACACTCCGATCAGAGATGA-3' 5'-AATGTTTCCGGAGTAGGGGAGTCTTTTT-3' β 2 M ... beacons for real-time PCR Name Sequence CollIA2 5'-FAM-cgtgccGGCAGCCAGTTTGAATATAATGTTGAAGGAggcacg-DABCYL-3' α-SMA 5'-FAM-cgtcgCCAAGGCCAACCGGGAgAAAAT...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Raised intrathecal levels of APRIL and BAFF in patients with systemic lupus erythematosus: relationship to neuropsychiatric symptoms" docx
... Imura Y, Fujii T, Nakayamada S, Tsujimura S, Nawata M, Iwata S, Azuma T, Mimori T, Tanaka Y: Efficacy of rituximab (anti-CD20) for refractory systemic lupus erythematosus involving the central ... single confirmatory diag- nostic test for NPSLE. Several clinical, laboratory, and radiographic test findings are reported to be abnormal in some but not all patients. Magnetic resonance i...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Acute myopathy secondary to oral steroid therapy in a 49-year-old man: a case report" docx
... within a few days of start- ing therapy. Five patients t olerated a low maintenance dose of prednisone (15 to 60 mg) for a duration of 60 to 240 days without any signs or symptoms of myopathy. However, ... strength of 5 of 5 in all muscle groups. Laboratory examination showed a CPK of 130U/L,ALTof82IU/LandASTof44U/L.Urine myoglobin results were negative. He...
Ngày tải lên: 11/08/2014, 00:22