báo cáo khoa học: " Trust and the regulation of pharmaceutic

báo cáo khoa học: " Trust and the regulation of pharmaceuticals: South Asia in a globalised world" ppt

... in data collection, and helped draft the manuscript. NR and MS were partners in the data collection in Nepal. SMR was a partner in the data collection and analysis of material from India. All authors ... over counterfeit, fake, substandard and spurious medicines, and quality standards in Indian generic companies, looking particularly at the role played by the...

Ngày tải lên : 11/08/2014, 14:21

13
360
0

Báo cáo khoa học: MicroRNAs and the regulation of ﬁbrosis potx

... therefore appears that although miRNAs predominately repress translation through binding within the 3¢-UTR of target mRNA, individual miRNAs might also increase mRNA translation and bind regions within the 5¢-UTR. There ... several organs, including heart, lung, kidney and liver (Fig. 1). miRNA and cardiac ﬁbrosis Cardiac ﬁbroblasts are the most numerous cell type in the h...

Ngày tải lên : 15/03/2014, 11:20

7
436
0

Báo cáo khoa học: Apoptosis and autophagy: Regulation of apoptosis by DNA damage signalling – roles of p53, p73 and HIPK2 ppt

... DNA damage facilitates activation of the DNA damage-activated protein kinases ATM and ATR. ATR and ATM in turn phosphorylation-dependently activate the downstream check- point kinases Chk1 and ... the DNA damage-activated kinase homeodomain-interacting protein kinase 2 (HIPK2). Abbreviations ATM, ataxia-telangiectasia mutated; ATR, ATM and Rad3-related; Bak, Bcl-2 homologo...

Ngày tải lên : 16/03/2014, 00:20

10
466
0

Báo cáo khoa học: "Evaporation and surface conductance of three temperate forests in the Netherlands" pdf

... most of this paper both the average and the maximum values of variables are shown. This gives an indi- cation of the statistical variation in the data, and allows a qualitative ... and as a maximum value. There is not always an equal number of points used in the calculation of the average. This limits the approach to s...

Ngày tải lên : 09/08/2014, 04:20

16
355
0

Báo cáo y học: "Insights into the regulation of intrinsically disordered proteins in the human proteome by analyzing sequence and gene expression data" potx

... be a feature of the way in which stability was measured. Attachment of an amino-ter- minal GFPS tag to a protein in the global protein stability assay may interfere with cellular localization and ... mRNA decay rates, microRNA (miRNA) targeting and ubiquitination have critical roles in the degradation and disposal of human proteins and transcripts. Here, we descr...

Ngày tải lên : 14/08/2014, 21:20

18
326
0

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGA AACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGG GT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and ... underlined. The F13 3A mutation was created using the following primers: F13 3A- fw (5¢-GTGGCTGGAACAGGA GCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGG CGCTCC...

Ngày tải lên : 18/02/2014, 16:20

12
656
0

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... Kaneko 1 , Yuanying Ding 1 , Kazuhiro Ogawa 2, *, Miki Yoshizawa 1 , Masaki Kawamura 1 , Kazuhisa Takeda 1 , Tadashi Yoshida 3 and Shigeki Shibahara 1 1 Department of Molecular Biology and Applied ... Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in h...

Ngày tải lên : 19/02/2014, 06:20

12
621
0

Báo cáo khoa học: Protein and mRNA content of TcDHH1-containing mRNPs in Trypanosoma cruzi pdf

... proteins, mRNA- binding proteins, initiation and elongation translation factors, ribosomal proteins and metabolic proteins. Abundant proteins, such as heat shock proteins and elongation factor 1a, ... 78 (Tc00.1047053506585.40),F,5¢-TGGCGGTAAGAAGAA GCAGT-3¢;R,5¢-CCGAGGTCAAACACAAGGAT-3¢; putative (H+)-ATPase G subunit (Tc00.1047053510993. 10),F,5¢-ACAACGTGCAAAGGCTTCTT-3 ¢;R,5¢-CTC GTGCCA...

Ngày tải lên : 15/03/2014, 23:20

12
481
0

Báo cáo khoa học: " Ecophysiology and field performance of black spruce (Picea mariana): a review" ppsx

... seedlings. In addition to carbo- hydrate and amino-acid accumulation in response to water stress, Zwiazek and Blake (199 0a) also observed an increase in major organic acids in ... of osmoregulation in expanded leaves of many species with sugars being apparently dominant in black spruce (Zwiazek and Blake, 199 0a; Tan et al, 199 2a, b). Co...

Ngày tải lên : 08/08/2014, 19:21

23
240
0

báo cáo khoa học: "Incidence and clinicopathologic behavior of uterine cervical carcinoma in renal transplant recipients" potx

... carcinoma followed by cervical carcinoma and bladder carcinoma. (Table 1). Clinicopathological analysis of cervical carcinoma that developed after a renal transplant The mean age at the time of ... included in the study. According to a retrospective review of the medical charts of these patients, 36 of them had malig- nancy. The incidence of carcinoma was analyze...

Ngày tải lên : 09/08/2014, 02:20

6
350
0