báo cáo khoa học: "Healthy lifestyle behaviour among Ghanaian adults in the phase of a health policy change" pdf
... 7:7 http://www.globalizationandhealth.com/content/7/1/7 Page 3 of 9 RESEARCH Open Access Healthy lifestyle behaviour among Ghanaian adults in the phase of a health policy change Henry A Tagoe and Fidelia AA Dake * Abstract Background: ... 4). Discussion This paper examined the trend in healthy lifestyle beha- viour among Ghanaian adults in the phas...
Ngày tải lên: 11/08/2014, 14:21
... sto- mach. His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent to the gastrojeju- nostomy and a drain by the duodenal repair and his abdomen closed. The drains were ... blunt abdominal trauma i n the presence of a large pancreatic pseudocyst. Minor blunt abdominal trauma in a normal healthy adult would not be expected to result in any sig-...
Ngày tải lên: 10/08/2014, 23:20
... and materials This work was approved by The University of Adelaide Animal Ethics Committee. Acetylcholine, atropine, concanavalin A, CCK-8 and CCK-8-NS were obtained from Sigma-Aldrich. Alamar ... Bioscience, The University of Queensland, Brisbane, Queensland, Australia Marsupials are born in an immature state and many of the developmental processes that occur in these mammal...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx
... perinuclear areas of the cell via its N-ter- minal ABD. In the absence of ligand, AR is localized predominantly in the cytoplasm, and its hinge domain and the LBD are tethered to the C-terminal end of FLNa ... transport of the AR, interacts with the AR DBD–LBD in a ligand-independent manner [77,86,87]. The absence of filamin hampers androgen- induced AR transa...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Functionally distinct dopamine and octopamine transporters in the CNS of the cabbage looper moth* potx
... insect; neurotransmitter; transporter; dopamine; octopamine; cocaine. The catecholamine dopamine (DA), the phenolamine octopamine (OA) and the indolamine serotonin (5-HT) in uence a variety of ... within the range reported for cloned mammalian DATs), our data suggest that DA is the primary natural substrate of TrnDAT and octopamine (and possibly tyramine) the natural substr...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Upstream and intronic regulatory sequences interact in the activation of the glutamine synthetase promoter pot
... be calculated with an approach based on the analysis of variance ( ANOVA ) technique. To normalize the data, the activity of reference construct A was set to 100 arbitrary units (AU) in these calculations. ... co-operative effects is that the binding of a factor to an element within such an array entails an increase in the affinity of adjacent elements for their corre...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Accessory proteins functioning selectively and pleiotropically in the biosynthesis of [NiFe] hydrogenases in Thiocapsa roseopersicina docx
... (Table 3). The results indicate that the two related putative proteins cannot replace one another in the matur- ation of the various hydrogenases. Discussion Thiocapsa roseopersicina harbors at ... the maturation of functionally active hydro- genases in T. roseopersicina and to understand their physio- logical roles. The determination of the specificity of the acces...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: "Major liver resection for hepatocellular carcinoma in the morbidly obese: A proposed strategy to improve outcome" doc
... 204:22-33. 25. Aoki T, Imamura H, Hasegawa K, Matsukura A, Sano K, Sugawara Y, Kokudo N, Makuuchi M: Sequential preoperative arterial and portal venous embolizations in patients with hepatocellular carcinoma. ... segment IV of the left lobe and segments V and VIII of the right lobe of the liver, partially occluding the proximal part of the common bile duct and causing mod...
Ngày tải lên: 09/08/2014, 07:21
Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf
... 262:13907-13915. 37. Nakata K, Tanaka Y, Nakano T, Adachi T, Tanaka H, Kaminuma T, Ishikawa T: Nuclear receptor-mediated transcriptional regu- lation in Phase I, II, and III xenobiotic metabolizing systems. Drug ... 369:583-591. 34. Kamiya A, Kinoshita T, Ito Y, Matsui T, Morikawa Y, Senba E, Nakashima K, Taga T, Yoshida K, Kishimoto T, Miyajima A: Fetal liver development requires a p...
Ngày tải lên: 12/08/2014, 04:22
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc
... (CAGGACAGCCTGCGCAACGAG), RVR (CAG GACAGGGTGCGCAACGAG), SVR (CAGGACAG CGTGCGCAACGAG) and SLC (AGGGTATCCCTC TGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... signal observed in all lanes loaded with bacterial protein. The CYP 6A2 variants have the same apparent molecularmassasCYP 6A2 fromD. melanogaster microsomes. The apoenzyme production...
Ngày tải lên: 19/02/2014, 12:20