báo cáo khoa học: "Turning a blind eye: the mobilization of radiology services in resource-poor regions" pot

... (intra-abdominal) Medical management Basic High Hydronephrosis Medical and surgical management Basic High Abdominal trauma Medical and surgical management Advanced High Abdominal masses Medical ... ures cap- able of overseeing the long-term maintenance, quality assurance, and financing of imaging programs, in addi- tion to similar capacity and infrastructure development of basic pub...

Ngày tải lên: 11/08/2014, 14:21

... x (a, a  ) factor in the in- equality). Finally, adding elements to A can only increase the chances of finding a pair of automatic summaries satisfying the condition in JACK. Figure 4: JACK values Figure ... constraints: it can be enlarged by increasing the similarity of the peers to the models (the x(m, a) factor in the in- equality) or decreasing the...

Ngày tải lên: 17/03/2014, 05:20

... through the scaling up of harm reduction programmes in many countries. Though there is no lack of evidence in support of methadone maintenance [5], debates have continued because of the relative scarcity ... the latter characterized by a combination of ease of access and the absence of obligatory requirement for staying on in the programme [9]. Restrictions imp...

Ngày tải lên: 11/08/2014, 18:20

... GTTTGAATTGGCCAGAGGAA reverse, TCTGTTGGAAAATCCCGTTC Cxcl10 forward, CCCACGTGTTGAGATCATTG reverse, GAGGAACAGCAGAGAGCCTC Cxcl10 pre-mRNA forward, AGCAGAGGAAAATGCACCAG reverse, CACCTGGGTAAAGGGGAGTGA Dusp16 ... CCTAGCTTGGCTGACAGAGG; reverse, CTGCTCCTTCTCCTTCATGC Asns forward, TACAACCACAAGGCGCTACA; reverse, AAGGGCCTGACTCCATAGGT Trb3 forward, CAGGAAGAACCGTTGGAGTT; reverse, TTGCTCTCGTTCCAAAAGGA Actb...

Ngày tải lên: 07/03/2014, 03:20

... causes the fatal human sleeping sickness, as well as Nagana, a devastating disease of domestic animals in large parts of sub-Saharan Africa. While many aspects of trypanosome cell biology have been ... and pET-PDE1 as template. PDE1(Arg189–Thr620) was amplified using the primer pairs 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC...

Ngày tải lên: 19/02/2014, 12:20

... structure of chromatin incorpor- ating them. To see whether the increased transcription leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a ... organization caused by TSA treatment Changes in the acetylation status of histones by TSA treatment may cause changes in the organization of chromatin. Such alter...

Ngày tải lên: 19/02/2014, 12:20

... aB-crystallin and a- lactalbumin contained a heavy precipitate, whereas the mixture of wild-type aB-crystallin and a- lactalbumin was clear. The sample of reduced a- lactalbumin, of course, con- tained ... disorder in humans characterized by intrasarcoplas- mic accumulation of desmin, and cataract [11]. Desmin filaments play an important role in cardiomyocytes, where they...

Ngày tải lên: 16/03/2014, 18:20

... state of the art. A manual error analysis reveals that parser errors account for many of the errors of our system. This analysis also suggests that simultaneous incremental parsing and semantic ... (Steedman, 2000) is a grammatical framework that describes syntactic structure in terms of the combinatory potential of the lexical (word-level) items. Rather than using sta...

Ngày tải lên: 17/03/2014, 01:20

... h at 37 °C, and the absorbance of formazan was then measured at 570 nm. Each treatment was performed in triplicate, and the percentage cell growth inhibition was calculated by comparison of the absorbance ... initiating the apoptotic program by antagonizing the function of the antiapoptotic BCL-2 and activating BAX and BAK [24]. Therefore, the expression of BIM ⁄ BOD w...

Ngày tải lên: 23/03/2014, 10:20

... (family FAD_bind- ing_9 in the clan FAD_Lum_binding). In addition, a novel covalent attachment between a side chain car- boxylate group of an aspartate and the 8a- position of the isoalloxazine system ... in catalysis, but may instead be involved in dimerization of the protein or act as a gate for potential substrates to enter the active site. On the other hand...

Ngày tải lên: 28/03/2014, 22:20