báo cáo khoa học: "Turning a blind eye: the mobilization of radiology services in resource-poor regions" pot
báo cáo khoa học: "Turning a blind eye: the mobilization of radiology services in resource-poor regions" pot
... (intra-abdominal) Medical management Basic HighHydronephrosis Medical and surgical management Basic HighAbdominal trauma Medical and surgical management Advanced HighAbdominal masses Medical ... ures cap-able of overseeing the long-term maintenance, qualityassurance, and financing of imaging programs, in addi-tion to similar capacity and infrastructure development of basic public health ... Case of Nyaya HealthNyaya Health is a non-profit organization run by Nepaland US-based health professionals. In collaboration with the Nepali Ministry of Health & Population, Nyayaoperates...
- 8
- 324
- 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... x (a, a ) factor in the in- equality). Finally, adding elements to A can onlyincrease the chances of finding a pair of automaticsummaries satisfying the condition in JACK.Figure 4: JACK valuesFigure ... constraints: itcan be enlarged by increasing the similarity of the peers to the models (the x(m, a) factor in the in- equality) or decreasing the similarity between au-tomatic summaries (the x (a, ... Dan Melamed.2003. Evaluation of Machine Translation and itsEvaluation. In In Proceedings of MT Summit IX,New Orleans,LA.C. Lin and E. H. Hovy. 200 3a. Automatic Evaluation of Summaries Using...
- 10
- 517
- 0
báo cáo khoa học: " Achieving a high coverage – the challenge of controlling HIV spread in heroin users" potx
... through the scaling up of harm reduction programmes in many countries. Thoughthere is no lack of evidence in support of methadonemaintenance [5], debates have continued because of the relative scarcity ... the latter characterized by a combination of ease of access and the absence of obligatory requirementfor staying on in the programme [9]. Restrictions imposedthrough the entrance criteria and ... ZG and JM participated in data analysis andcontributed to study design; SL prepared the manuscriptand incorporated opinions from all others.Acknowledgements The authors thank all staff and...
- 4
- 264
- 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... GTTTGAATTGGCCAGAGGAAreverse, TCTGTTGGAAAATCCCGTTCCxcl10 forward, CCCACGTGTTGAGATCATTGreverse, GAGGAACAGCAGAGAGCCTCCxcl10pre-mRNAforward, AGCAGAGGAAAATGCACCAGreverse, CACCTGGGTAAAGGGGAGTGADusp16 ... CCTAGCTTGGCTGACAGAGG;reverse, CTGCTCCTTCTCCTTCATGCAsns forward, TACAACCACAAGGCGCTACA;reverse, AAGGGCCTGACTCCATAGGTTrb3 forward, CAGGAAGAACCGTTGGAGTT;reverse, TTGCTCTCGTTCCAAAAGGAActb forward, AAGGAAGGCTGGAAAAGAGCreverse, ... AGGCCACTGACTAGGCTGAAEgr1pre-mRNAforward, GAGCAGGTCCAGGAACATTGreverse, GGGATAACTCGTCTCCACCANdrg1 forward, ACCTGCTACAACCCCCTCTTreverse, TGCCAATGACACTCTTGAGCIdi1 forward, GGGCTGACCAAGAAAAACreverse,...
- 12
- 560
- 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. While many aspects of trypanosome cell biologyhave been ... and pET-PDE1as template. PDE1(Arg189–Thr620) was amplified using the primer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) ... University)using Takara Taq polymerase (BioWhittaker) and 30 cycles of 30 s at 94 °C, 2 min at 58 °C and 5 min at 72 °C. Foramplification, the primer pairs 5¢-GGGAATTCCATATGCTTGAGGCTTTGCGAAAGTGCCCGACCATGTTTG-3¢...
- 11
- 566
- 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... structure of chromatin incorpor-ating them. To see whether the increased transcriptionleakage observed at early addition of TSA can be explainedby an accumulation of acetylated forms of histones in a ... organizationcaused by TSA treatmentChanges in the acetylation status of histones by TSAtreatment may cause changes in the organization of chromatin. Such altered chromatin may no longer be ableto ... any change in the level of AcH4following treatment with TSA, but we did see a distinct andtime-dependent increase in the hyperacetylation of histoneH3 as well as an increased acetylation at...
- 10
- 500
- 0
Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt
... aB-crystallin and a- lactalbumincontained a heavy precipitate, whereas the mixture of wild-type aB-crystallin and a- lactalbumin was clear. The sample of reduced a- lactalbumin, of course, con-tained ... disorder in humans characterized by intrasarcoplas-mic accumulation of desmin, and cataract [11]. Desminfilaments play an important role in cardiomyocytes,where they maintain the structural integrity ... discovery that a naturally occurring mutation at the equivalent position in aA-crystallin, R116C, caused congenital cataract in humans [12]. In aA-crystallin and aB-crystallin, R116and R120, respectively,...
- 14
- 366
- 0
Báo cáo khoa học: "Brutus: A Semantic Role Labeling System Incorporating CCG, CFG, and Dependency Features" pot
... state of the art. A manual error analysis reveals that parser errorsaccount for many of the errors of our system.This analysis also suggests that simultaneousincremental parsing and semantic ... (Steedman, 2000)is a grammatical framework that describes syntacticstructure in terms of the combinatory potential of the lexical (word-level) items. Rather than using standardpart -of- speech tags ... categories drawn from a 3 word window around the target word, witheach associated with a binary indicator feature.(4) Predicate. The lemma of the predicate we aretagging. E.g. fix is the lemma of fixed.(5)...
- 9
- 282
- 0
Báo cáo khoa học: Ixocarpalactone A isolated from the Mexican tomatillo shows potent antiproliferative and apoptotic activity in colon cancer cells pot
... h at 37 °C, and the absorbance of formazan was then measured at 570 nm. Eachtreatment was performed in triplicate, and the percentage cellgrowth inhibition was calculated by comparison of the absorbance ... initiating the apoptotic programby antagonizing the function of the antiapoptoticBCL-2 and activating BAX and BAK [24]. Therefore, the expression of BIM ⁄ BOD was evaluated by westernblot analysis. ... these compounds in combinatorial therapywith more traditional chemotherapeutics has beensuggested, with the aim of lowering the toxicity andenhancing the efficacy of treatments of more advancedcancers.As...
- 10
- 310
- 0
Báo cáo khoa học: Flavogenomics – a genomic and structural view of flavin-dependent proteins potx
... (family FAD_bind-ing_9 in the clan FAD_Lum_binding). In addition, a novel covalent attachment between a side chain car-boxylate group of an aspartate and the 8a- position of the isoalloxazine system ... in catalysis,but may instead be involved in dimerization of the protein or act as a gate for potential substrates toenter the active site. On the other hand, the flavin in the pyruvate kinase ... are available for about half of the flavo-proteins. FAD-containing proteins predominantly bind the cofactor in a Rossmann fold ( 50%), whereas FMN-containing proteins preferablyadopt a (ba)8-(TIM)-barrel-like...
- 10
- 460
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI