... et al., "For someone who's rich, it's not a problem". Insights from Tanzania on diabetes health-seeking and medical pluralism among Dar es Salaam's urban poor Globalization ... who's rich, it's not a problem". Insights from Tanzania on diabetes health-seeking and medical pluralism among Dar...
Ngày tải lên: 11/08/2014, 14:21
... tubes. Radioactivity was measured using a gamma counter (LKB, Wallac, Finland). All animals were maintained and handled according to local and national ethical guidelines. Animal model of septic ... and handled according to local and national ethical guidelines. Statistical analysis Data are represented as means ± SD. The significance of the results was assessed using one-way ANOVA i...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc
... dissociation constant and P o is the total peptide concentration. The last term in the equation takes into account slight aggregation that may take place at higher protein concentrations. Data fitting ... Pestana A (2005) RB1 gene mutation up-date, a meta-analysis based on 932 reported mutations available in a searchable data- base. BMC Genet 6, 53. 4 Burkhart DL & Sage J (2008)...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: "ACQUIRING CORE MEANINGS OF WORDS, REPRESENTED AS JACKENDOFF-STYLE CONCEPTUAL STRUCTURES, FROM CORRELATED STREAMS OF LINGUISTIC AND NON-LINGUISTIC INPUT" potx
... representation of nondeterministic values and non-directional computation. Nondeterministic mental representations are expressed in the naive im- plementation via backtracking. Expressing nonde- ... information from input such as this. 3 Architecture MAIMRA operates as a collection of modules which mutually constrain various mental representations: The organization of these module...
Ngày tải lên: 24/03/2014, 02:20
báo cáo khoa học: "Interest in quantitative genetics of Dutt’s and Deak’s methods for numerical computation of multivariate normal probability integrals" potx
... correlation matrix, it is possible to generate sets of n correlated standardized normal variables from n independent normal variables. The position of these variables with respect ... SMITH & QuAAS, 1982) or use approximations such as, for example, the assumption of preservation of normality for all the variables after truncation selection o...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: " Bundling occupational safety with harm reduction information as a feasible method for improving police receptiveness to syringe access programs: evidence from three U.S. cities" ppt
... enforcement officers are unaware of the public health benefits and legal status of these programs and may continue to treat the possession of injection equipment as illegal and program participation as a marker ... specific ways they shape the depart- ment's standard operating procedures, including changes in search, arrest, and referral activities. It also describes proper occ...
Ngày tải lên: 11/08/2014, 18:20
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... 254, 311–314. 27 DeLean A, Munson PJ & Rodbard D (1978) Simul- taneous analysis of families of sigmoidal curves: application to bioassay, radioligand assay, and physiological dose–response curves. Am J Physiol ... [16–18]. Amino acid sequences are consid- erably conserved among ERRs and ERs, especially in their DNA-binding domain and ligand-binding domain (LBD). However, 17b-estr...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf
... {kasper,calcagno,pcdavis) @ling.ohio-state.edu Abstract Nonconcatenative constraints, such as the shuffle re- lation, are frequently employed in grammatical anal- yses of languages that have ... head-wrapping operations, and Moortgat's (1996) extraction and infixation op- erations in (categorial) type-logical grammar. What is common to the proposals of Dowty, Reape, and Kath...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 [43, 50, 47, 46, 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA ... multiplication as a target for therapeutic action Jamal Tazi 1 , Nadia Bakkour 1 , Virginie Marchand 2 , Lilia Ayadi 2 , Amina Aboufirassi 1 and Christiane Branlant 2 1 Universite ´ Mo...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Inactivation of annexin II tetramer by S-nitrosoglutathione pot
... Biomembrane, Vancouver, Canada). Preparation of lamellar bodies Lamellar bodies were isolated from male Sprague–Dawley rat lung tissue by upward flotation [42] on a discontinuous sucrose gradient ... annexin was added to initiate liposome aggregation and incubation continued for 30 min. At the end of incubation, the absorbance at 540 nm (A 30 540nm ) was read again. The aggregation ac...
Ngày tải lên: 08/03/2014, 10:20