báo cáo khoa học: "Transformational leadership, transnational culture and political competence in globalizing health care services: a case study of Jordan''''''''s King Hussein Cancer Center" pps

báo cáo khoa học: "Transformational leadership, transnational culture and political competence in globalizing health care services: a case study of Jordan''''s King Hussein Cancer Center" pps

báo cáo khoa học: "Transformational leadership, transnational culture and political competence in globalizing health care services: a case study of Jordan''''s King Hussein Cancer Center" pps

... supporting patient interaction in Arabic. Arabic was used as the primary lan- guage for patient, family, and local physician interactions; training and engagement with staff in the clinical setting; and ... 1 of 13 (page number not for citation purposes) Globalization and Health Open Access Research Transformational leadership, transnational culture and political co...

Ngày tải lên: 11/08/2014, 14:21

13 418 0
Báo cáo khoa hoc:" Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case report" ppsx

Báo cáo khoa hoc:" Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case report" ppsx

... citation purposes) Journal of Medical Case Reports Open Access Case report Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case ... reported a similar case in which DIPNECH was associated with a carcinoid [5]. The current report represents the first case of a patient with DIPNECH accompanied by a pulm...

Ngày tải lên: 11/08/2014, 10:23

3 356 0
báo cáo khoa học: " Improving outcomes for ill and injured children in emergency departments: protocol for a program in pediatric emergency medicine and knowledge translation science" potx

báo cáo khoa học: " Improving outcomes for ill and injured children in emergency departments: protocol for a program in pediatric emergency medicine and knowledge translation science" potx

... Ottawa, Canada, 6 Department of Statistics, University of British Columbia, Vancouver, Canada, 7 Canadian Institutes of Health Research, Ottawa, Canada, 8 Department of Family Medicine, Faculty ... University of Ottawa, Ottawa, Canada, 4 Department of Pediatrics, Faculty of Medicine, University of Calgary, Calgary, Canada, 5 Departments of Pediatric and Emergency...

Ngày tải lên: 11/08/2014, 16:20

7 231 0
Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... these amino acids and amino acid derivatives, and values of DG D °, measured in triplicate, are given in Table 1. The effect of polyols on the kinetic parameters (K m and k cat ) of the RNase -A mediated ... R. Singh*,, Tanveer A. Dar*,à, Vikas Rishi§ and Faizan Ahmad Centre for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, New Delhi, India Introdu...

Ngày tải lên: 07/03/2014, 00:20

9 547 0
Báo cáo khoa học: Structural origins for selectivity and specificity in an engineered bacterial repressor–inducer pair pdf

Báo cáo khoa học: Structural origins for selectivity and specificity in an engineered bacterial repressor–inducer pair pdf

... converged at an R work of 20.7% and an R free value of 26.1%. The ligand 4-ddma-atc and ligand restraints parameters were generated using corina [26]. The individual models were validated using the software ... previously available biochemical characterization, represent a challenging benchmark data set for testing and validat- ing computational models aimed at predicting and de...

Ngày tải lên: 16/03/2014, 00:20

12 502 0
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

... Zachary J. Kraus and Pamela L. Schwartzberg National Human Genome Research Institute, National Institutes of Health, Bethesda, MD, USA Introduction Among the key players in intracellular signaling ... signaling, required for full activation of phospholipase Cc, and downstream Ca 2+ and ERK- mediated signaling pathways. Over the last 10 years, data have implicated the Tec family k...

Ngày tải lên: 28/03/2014, 22:21

10 312 0
Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx

Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx

... knockdown of caIII mRNA and protein and enhanced caspase 3 catalytic activity in Rat1 cells. Fig. S2. DsiRNA-mediated knockdown of caIII mRNA and protein and caspase 3 catalytic activity in Rat1 cells ... TAMRA rat caIII probe: cttcaccacgccaccctgc gag 5¢ rat gapdh: gggcagcccagaacatca 3¢ rat gapdh: ccgttcagctctgggatgac 5¢ 6-FAM, 3¢ TAMRA rat gapdh probe: ccctgcatccactgg tgctgcc...

Ngày tải lên: 29/03/2014, 08:20

12 446 0
Báo cáo khoa học: Unchanged thymidine triphosphate pools and thymidine metabolism in two lines of thymidine kinase 2-mutated fibroblasts docx

Báo cáo khoa học: Unchanged thymidine triphosphate pools and thymidine metabolism in two lines of thymidine kinase 2-mutated fibroblasts docx

... metabolism in two lines of thymidine kinase 2-mutated fibroblasts Miriam Frangini 1 , Chiara Rampazzo 1 , Elisa Franzolin 1 , Mari-Carmen Lara 2 , Maya R. Vila ` 2 , Ramon Martı ´ 2 and Vera Bianchi 1 1 ... min of incubation, the dTTP pool had reached a specific radioactivity of about 7000 c.p.m.Æpmol )1 in Ca and Pb cells, and about 5000 in Cb and Pa cells (Fig. 2B), indi...

Ngày tải lên: 30/03/2014, 02:20

10 309 0
Báo cáo khoa học nông nghiệp " Genetic materials and silvicultural techniques in plantation-grown acacias for sawn timber products " pot

Báo cáo khoa học nông nghiệp " Genetic materials and silvicultural techniques in plantation-grown acacias for sawn timber products " pot

... areas: 9 A. auriculiformis: Centre and South 9 A. mangium: North 9 A. crassicarpa: centre and south 9 Acacia hybrid: North, Centre and South  High land areas: A. mearnsii (Bodalla and Nowa ... techniques in plantation-grown acacias for sawn timber products Collaboration in Agriculture and Rural Development Project VIE:032/05 “Sustainable and profitable development o...

Ngày tải lên: 21/06/2014, 05:20

24 327 0
w