Báo cáo y học: "Acute lymphocytic crisis following herpes simplex type 1 virus hepatitis in a nonimmunocompromised man: a case report" pptx

... lymphocytes: an absolute increase in mature normal-appearing small lymphocytes, as seen in pertussis and infectious lymphocytosis, and an absolute increase in larger lymphocytes with abundant basophilic ... http://jmedicalcasereports.com/jmedicalcasereports/article/view/7492 In our case, the qualitative immunoenzymatic determina- tion of IgG-class and IgM-class antibodies against HSV...

Ngày tải lên: 11/08/2014, 14:20

... reported fatal case of acute liver failure in a patient with high-output cardiac failure due to arteriovenous hemodialysis access. Case presentation An 84-year-old Caucasian man with a history of hyper- ten ... CAS E RE P O R T Open Access Acute liver failure following hemodialysis arteriovenous graft placement: a case report Zachary Z Brener 1* , Augusto D Paiusco 1 , Mic...

Ngày tải lên: 11/08/2014, 03:21

... reported fatal case of acute liver failure in a patient with high-output cardiac failure due to arteriovenous hemodialysis access. Case presentation An 84-year-old Caucasian man with a history of hyper- ten ... CAS E RE P O R T Open Access Acute liver failure following hemodialysis arteriovenous graft placement: a case report Zachary Z Brener 1* , Augusto D Paiusco 1 , Mic...

Ngày tải lên: 11/08/2014, 07:20

... these pathways has a modulatory r ather than a mandatory role to play in mediating the proliferative response. In contrast, a recent report has shown that tryptase induces DNA synthesis in canine ... PAR4 [27]. Thrombin has been shown t o cleave and a ctivate PAR1, PAR3 and PAR4, whereas trypsin cleaves and activates PAR2. As duodenase is capable of cleaving certain substrates w...

Ngày tải lên: 24/03/2014, 03:21

... cocaine abuse among individu- als with schizophrenia: a feasibility study. Psychiatry Res 2004, 12 5: 61- 64. 10 . Shaner A, Roberts LJ, Eckman TA: Monetary reinforcement of abstinence from cocaine ... consenting to part icipate or already using financial incentives Allocated to intervention: M4M 17 AOTs, 68 participants average cluster size = 4 Approached for participation: 10 0 A...

Ngày tải lên: 11/08/2014, 17:20

... initial imaging studies also did not indicate a likely aetiology. It was only on endoscopy that other more common causes such as primary intestinal lym- phangiectasia, inflammatory diseases and infection ... is caused by either diffuse nodal infiltration obstructing intestinal lymphatics or a primary mucosal lymphoma located more distally in the small intestine [1- 3]. However, primary...

Ngày tải lên: 11/08/2014, 17:21

... follows: 1. Type A1 : partially separated pulmonary trunk. 2. Type A2 : two pulmonary arteries arising directly from the truncus arteriosus. 3. Type A3 : a single pulmonary artery originating from the arterial ... shunting. Clinical manifestations are usually apparent shortly after birth. The most common findings are dyspnea, tachycardia, cyanosis, and progressive heart failure. L...

Ngày tải lên: 11/08/2014, 23:21

... 432 DenSi-2 AACUGUGCAUUGAAGCCAAAA 929 DenSi-3 AACAGGGCUAGACUUCAAUGA 13 20 DenSi-4 AAGAAGAAUGGAGCGAUCAAA 13 3 control siRNA UUCUCCGAACGUGUCACGUdT – Four siRNA sequences (table 1) against different parts ... μg/mL penicillin a nd streptomycin, pH 7.4 (maintain medium). Cells were passaged every 5 to 7 days to maintain exponential growth. DEN -1 strain GZ02- 218 was passaged by infecting m...

Ngày tải lên: 12/08/2014, 01:22

... HM, Murphy TM, Drinan EM, Rice D: Acute skeletal myopathy in farmed Atlantic salmon, Salmo salar. Dis Aquat Organ 19 91, 12 :17 -23. 53. Houghton G, Ellis AE: Pancreas disease in Atlantic salmon: ... Ct-values obtained for the target gene (nsP1-assay) were normalized against the endogenous control EF 1A A -assay (tissues) whereas plasma samples were normalized against the VHSV08- assay...

Ngày tải lên: 12/08/2014, 04:20

... of 3 CASE REPO R T Open Access Acute hepatitis in a woman following excessive ingestion of an energy drink: a case report Abhirami Vivekanandarajah * , Shirley Ni and Alain Waked Abstract Introduction: ... worsening pain and new-onset jaundice. This time her physical examination revealed epigastric tenderness and icteric sclera. Her aspartate aminotransferase, alanine aminotrans...

Ngày tải lên: 10/08/2014, 23:21