báo cáo khoa học: " Classification of unknown primary tumors with a data-driven method based on a large microarray reference database" ppsx

... unknown primary tumors with a data-driven method based on a large microarray reference database Kalle A Ojala, Sami K Kilpinen and Olli P Kallioniemi * Abstract We present a new method to analyze ... scienti- fic data. Additional material Additional file 1: An illustration of the method used to calculate similarities between a test sample and the referen...

Ngày tải lên: 11/08/2014, 12:21

... Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana Ling-Ling Chen 1 and Feng Gao 2 1 Laboratory for Computational Biology, Shandong ... it a model plant for research [16]. The compositional organization of the A. thaliana genome has been studied by several groups [5,7]. Carels and Bernardi analyzed the contig...

Ngày tải lên: 30/03/2014, 20:20

... ,+ At5G52310 RD2 9A Promoter  Drt1 Drt2 Drt3  TTAGGATGGAATAAATATCATACCGACATCAGTTTGAAAGAAAAGGGAAAAAAAGAAAAAATAAATAAAAGATATACTACCGACATGAGTTCCAAAAAGCAAAAAAAAAGATCAAGCCGACACAG ATACCGACATC: ... ACCGACATGA Drought: GCCGACAC ATACCGACATC: DREB1Aox DREB1Aox: ACCGACATGAG ABA: AGCCGACACA TACCGACAT: DRE DRE: TACCGACAT DRE-core: GCCGAC   Drt4 Drt5 ACACGCGTAGAGAGCAAAATGACTTTGACGTCACACCACGA...

Ngày tải lên: 11/08/2014, 11:21

... (collocations) within a fixed-size window. Given that candidate terms extraction in LEXTER is based on a morpho- syntactical analysis, our definition allows us to group collocation information ... lan- guage and specialised data analysis functions from Splus TM software. Given the individuals-variables matrix above, a similarity measure between the individuals is calcu- l...

Ngày tải lên: 22/02/2014, 03:20

... which conjunctions of morphemes are valid. Thus valid analyses re- quire a valid segmentation and a valid morpho- syntax. In the larger descriptions developed in the system a "categorial ... basic mor- phology system has been modified to analyse words containing morphemes that are not in the lexicon. The analysis method offers segmenta- tion and morphological analysis (...

Ngày tải lên: 09/03/2014, 01:20

... proposition and rnodality, TM analysis of modality is as indispensable as that of proposition for natural language understanding and machine translation. However studies on natural language analysis ... types of the semantic relations, namely, case relation, noun concept relation, embeding relation and conjunctive relation. All of these semantic relations are analyzed in a...

Ngày tải lên: 24/03/2014, 01:21

... h1 1" alt =""

Ngày tải lên: 08/08/2014, 19:21

... reconciliation was carried out into a single forward translation and first version. Back translation The back translator who was a native speaker of the ori- ginal language English and unaware of ... of these organizations. For example the mediX organization has been one of the first mana- ged care organizations in Switzerland focusing on gate keeping and on a team based p...

Ngày tải lên: 12/08/2014, 01:21

... forms a stacking interaction with a guanine, and adopts a closed conformation of the active site. Asn41 has an identical conformation in all structures that we compared. The main role of this ... main chain nitrogen of Arg42 and O6 of the leading guanine. Accuracy of the docking was assessed on the basis of scoring values calculated by glide. Analysis of the positions...

Ngày tải lên: 18/02/2014, 11:20

... Kajimura N, Yamazaki M, Morikawa K, Yamazaki A & Mayanagi K (2002) Three-dimensional structure of non-activated cGMP phosphodiesterase 6 and compari- son of its image with those of activated ... H, Matsuura I, Hayashi F, Yamazaki RK & Usukura J (2010) Mechanism for the regulation of mammalian cGMP phosphodiesterase 6. 2: isolation and characterization of the transducin-...

Ngày tải lên: 06/03/2014, 00:21