báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

... 4 pMIR- REPORT 3' UUCCCUAAGGACCCUUUUGACCUG 5' |||||||||| 5' CUUGAAGAGAUAAGAAAACUGGAU 3' 5' CUUGAAGGGAAGACAAAACUGGAU 3' 5' UUUGAAGAGAUAAGAAAACUGGAU 3' 5' CUUGAAGAGAAAACAAAACUGGAU ... UGAAG-UCCCUGCCC-AACUGGAA 3' 5' UGAAG-UUUUCACCC-AACUGGAA 3' 3' UUCCCUAAGGACCCUU UUGACCUG 5' ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 3&a...
Ngày tải lên : 11/08/2014, 12:20
  • 12
  • 242
  • 0
Báo cáo khoa học: Wild-type p53 enhances annexin IV gene expression in ovarian clear cell adenocarcinoma docx

Báo cáo khoa học: Wild-type p53 enhances annexin IV gene expression in ovarian clear cell adenocarcinoma docx

... Itamochi H, Kigawa J, Akeshima R, Sato S, Kamazawa S, Takahashi M, Kanamori Y, Suzuki M, Ohwada M & Terakawa N (2002) Mechanisms of cisplatin resis- tance in clear cell carcinoma of the ovary. ... paclitaxel and carboplatin. Cancer Lett 241, 289–300. 41 Gorai I, Nakazawa T, Miyagi E, Hirahara F, Nagashima Y & Minaguchi H (1995) Establishment and characterization of two hum...
Ngày tải lên : 22/03/2014, 16:20
  • 14
  • 343
  • 0
Báo cáo khoa học: Bile acids increase hepatitis B virus gene expression and inhibit interferon-a activity pot

Báo cáo khoa học: Bile acids increase hepatitis B virus gene expression and inhibit interferon-a activity pot

... 5¢-CAGTTAACAAGCATTCAGCCAAC- 3¢; SHP: forward primer: 5¢-AGCTATGTGCACCTCATC GCACCTGC-3¢, reverse primer: 5¢-CAAGCAGGCTGGT CGGAATGGACTTG-3¢; and b-actin: forward primer: 5¢- GACTACCTCATGAAGATC-3¢, ... nonfat dry milk. The bands were detected using an enhanced chemiluminescence system (Amersham Phar- macia, Piscataway, NJ, USA). Statistical analysis Statistical analyses were conducted using...
Ngày tải lên : 22/03/2014, 21:21
  • 12
  • 359
  • 0
Báo cáo khoa học: "Mycorrhization helper bacteria associated with the Douglas fir-Laccaria laccata symbiosis: effects in aseptic and in glasshouse conditions" potx

Báo cáo khoa học: "Mycorrhization helper bacteria associated with the Douglas fir-Laccaria laccata symbiosis: effects in aseptic and in glasshouse conditions" potx

... summarized in table IV show that ≈ 30% of the bacteria isolated from mycorrhizas or sporocarps of L laccata act as helpers and enhance the mycorrhizal development of ... Pseudotsuga menziesii / Laccaria laccata Résumé — Les bactéries auxiliaires de la mycorhization associées à la symbiose Douglas- Laccaria laccata; effets en con...
Ngày tải lên : 08/08/2014, 23:21
  • 13
  • 385
  • 0
Báo cáo y học: " Indirect genomic effects on survival from gene expression data" doc

Báo cáo y học: " Indirect genomic effects on survival from gene expression data" doc

... and protein data can also be included in the same analysis, providing a more comprehensive analysis of pathways. Materials and methods Path analysis and graphical models The basic idea of graphical ... statistical computing and graphics. The additive hazard regression analysis was done using the freely available R package addreg [46]. An R package implementation of our app...
Ngày tải lên : 14/08/2014, 08:20
  • 14
  • 290
  • 0
Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt

Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt

... efficient catalysis, and that covalent flaviny- lation of the apoprotein proceeds via an autocatalytic event [5,6]. As well as oxidizing alcohols, the fungal enzyme is also able to perform amine oxidations, ... The cofactor incorporation resulted in formation of holo dimeric EUGO, in which all FAD is covalently bound. Covalent flavinylation was accompanied by an increase in oxida...
Ngày tải lên : 07/03/2014, 09:20
  • 11
  • 520
  • 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... (5¢-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) ... isoalloxa- zine ring resulting in a loss of absorbance at these wavelengths. During the addition of the first equivalent of NADPH there is a decrea...
Ngày tải lên : 07/03/2014, 17:20
  • 12
  • 420
  • 0
Báo cáo khoa học: Discovery of GSK837149A, an inhibitor of human fatty acid synthase targeting the b-ketoacyl reductase reaction pot

Báo cáo khoa học: Discovery of GSK837149A, an inhibitor of human fatty acid synthase targeting the b-ketoacyl reductase reaction pot

... homogenates (data not shown), demon- strating that the ability to inhibit FAS is genuine and is not an artefact generated by the use of recombinant enzyme, and also demonstrating that such inhibition ... other hand, when acetyl-CoA and malonyl- CoA were used as substrates, their disappearance ran in parallel with the release of free CoA, whereas no other intermediate of the...
Ngày tải lên : 16/03/2014, 06:20
  • 12
  • 391
  • 0
Báo cáo khoa học: "Discovery of Topically Coherent Sentences for Extractive Summarization" doc

Báo cáo khoa học: "Discovery of Topically Coherent Sentences for Extractive Summarization" doc

... Final Experiments In this section, we qualitatively compare our models against state -of- the art models and later apply an in- trinsic evaluation of generated summaries on topical coherence and ... /nw j (1) where w id indicates a word in a document d that ex- ists in s j and is sampled as summary related based on random indicator variable x id . nw j is the num- ber...
Ngày tải lên : 23/03/2014, 16:20
  • 9
  • 314
  • 0
Báo cáo khoa học: " Discovery of common marburgvirus protective epitopes in a BALB/c mouse model" potx

Báo cáo khoa học: " Discovery of common marburgvirus protective epitopes in a BALB/c mouse model" potx

... of Laboratory Ani- mal Care International. Statistical analysis Data collected from the animal survival studies were dis- played on a Kaplan-Meyer plot. Statistical significance was determined ... conducted in compliance with the Animal Welfare Act, federal stat- utes and regulations relating to animals and experiments involving animals, and adhered to principles stated in the G...
Ngày tải lên : 12/08/2014, 04:20
  • 9
  • 325
  • 0
Từ khóa: