Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx
Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx
... 24:2227-2236.doi:10.1186/1752-1947-4-183Cite this article as: Conti et al.: Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report. Journal of Medical Case Reports ... 43-year-old man with a severe form of atherosclerosis: a case reportMaria Conti1, Francesca Sanna2, Giulia AM Farci3, Sabrina Uda2, Giovanna Porcu2, Maria Collu4, Rosa R Bonatesta2,Barbara ... promote a synergistic inflammatory response capable of exacerbating atherosclerosis [7-9]. A case of severe atherosclerosis in a 43-year-old patient who had no conventional risk factors, but with a known...
- 5
- 409
- 0
Báo cáo y học: " Predictors and correlates for weight changes in patients co-treated with olanzapine and weight mitigating agents; a post-hoc analysis" docx
... risk of weight gain. A meta-analysis by Allisonand colleagues showed a significantly greater incidence of weight gain in patients treated with clozapine or olanzap-ine compared with patients ... just initiated on olanzapine treatment.Finally, we cannot exclude the possibility that nizatidineis less effective than amantadine or sibutramine as a weight-mitigating agent. Since the analysis ... potential phar-macologic agents to gain a better understanding of patients who may or may not respond to a particular strat-egy.Clinicians can help mitigate the potential weight gaintemporally associated...
- 11
- 497
- 0
Báo cáo y học: "Specific IgE response to purified and recombinant allergens in latex allergy" pptx
... latex allergy [3,5]. Among the 21 SBpatients studied, 13 had clinical latex allergy [11]. Latexallergy in health care workers was diagnosed by (a) a his-tory of skin and respiratory symptoms ... demonstration of antibody to latex antigens and a history of cross-reaction to food allergens [11]. All sera were evaluated for latexspecific IgE antibody using a Malaysian non-ammoniatedlatex extract, ... were analyzed by the multivariate analysis of variance (MANOVA). A P-value of 0.05 was consideredsignificant. When a significant difference was detected, a stepwise discriminant analysis was also...
- 9
- 388
- 0
Báo cáo y học: "Genomic transcriptional response to loss of chromosomal supercoiling in Escherichia coli" doc
... to those 13arrays only.Additional data filesThe following additional data files are available with theonline version of this paper: Additional data file 1 containsdata on the induction of ... of our data (21arrays measuring responses to DNA relaxation, and 14 con-trol arrays with negatively supercoiled DNA) minimized theinfluence of any single array measurement. Thus we can beconfident ... assistance and useful discussion. We also thank Sydney Kustuand Dan Zimmer for assistance with array printing and databases. Finally wethank Lisa Postow for help with data processing and Figure 6, and...
- 16
- 289
- 0
Báo cáo y học: "Polarized monocyte response to cytokine stimulation" pps
... TGGATCCAAAACTACTCGGAAGAMMP9 r: GAAGGCGCGGGCAAAMMP9 p: FAM-CGCGGGCGGTGATTGACGAC-TAMRAMMP19 f: GACGAGCTAGCCCGAACTGAMMP19 r: TTTGGCACTCCCGTAAACAAAMMP19 p: FAM-TCAGCAGCTACCCCAAACCAATCAAGG-TAMRAMannose ... inflammation [27].Validation of microarray analysis by TaqMan real-time PCR To define the validity and accuracy of our global microarrayanalysis, quantitative TaqMan real-time PCR was performedon ... GCACTGGGTCATCTTCATCAATTIL1 rec p: FAM-ACATTGCTTACTGGAAGTGGAATGGGT-CAG-TAMRATRAF bp f: TTGCTTACAG AGGTGTCTCAACAAGTRAF bp r: CTCCGGATTTGTTCTGTCAGTTCTRAF bp p: FAM-AGCAAAGTGTATTCCAGCAATGGTGT-GTCC-TAMRAMMP9...
- 16
- 233
- 0
Báo cáo y học: "The genomic response to 20-hydroxyecdysone at the onset of Drosophila metamorphosis" ppsx
... separately for microarray analysis.Microarray and cluster analysisAll experiments for microarray analysis were performed inde-pendently, in triplicate, to facilitate statistical analysis. TotalRNA ... generated by PCR from genomic DNA using thefollowing pairs of primers: hairy forward (F),5'CAAATTGGAAAAGGCCGACA3'; hairy reverse (R),5'AGAGAAACCCTAAGCGGCTT3'; cabut F,5'CTCTTCTAGTAGCCAAGACG3'; ... F,5'TCTCCACGAACTGGAGAACG3'; brain tumor R,5'TGATGGTGTGACTGTTGGTGG3'; vrille F,5'ACAGTTGTTGGCATCGCTGC3'; vrille R,5'GACAACAAGAAGGACGAGAGC3'.Additional...
- 13
- 306
- 0
Báo cáo y học: "Maternal Outcomes According to Placental Position in Placental Previa"
... 11. Ogawa M, Sato A, Yasuda K, et al. Cesarean section by transfundal approach for placenta previa percreta attached to anterior uterine wall in a woman with a previous repeat cesarean section: ... associated with peripartum cesarean hysterectomy in women with placenta previa. Am J Perinatol. 2008; 25:37-41. 7. Bahar A, Abusham A, Eskandar M, et al. Risk factors and pregnancy outcome in different ... transfusion, placental accreta and hysterectomy significantly increased. This implies that in placental previa patients, the location of placenta beneath incision site is a risk fac-tor of maternal morbidity...
- 6
- 503
- 0
Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt
... [2,3].The autophagic pathway is crucial for maintainingcell homeostasis and disruption to the pathway can be a contributing factor to many diseases. Decreasedautophagy may promote the development of ... steady-state autophagywithout a corresponding increase in cumulative auto-phagy would indicate a defect in autophagosome clear-ance (a failure to route autophagosome to lysosomesor to degrade ... a class III phosphatidylinositol 3-kinase-interacting protein [11], plays a role in promotingautophagy [12]. Beclin 1 contains a Bcl-2-bindingdomain which may serve as a point of cross-talk...
- 14
- 444
- 0
Báo cáo y học: "Rituximab therapy reduces activated B cells in both the peripheral blood and bone marrow of patients with rheumatoid arthritis: depletion of memory B cells correlates with clinical response" potx
... Tokunaga M, Saito K, Kawabata D, Imura Y, Fujii T, Nakayamada S,Tsujimura S, Nawata M, Iwata S, Azuma T, Mimori T, Tanaka Y: Efficacy of rituximab (anti-CD20) for refractory systemic lupuserythematosus ... down-regu-lation of the T cell costimulatory molecule CD40 ligand: anopen-label trial. Arthritis Rheum 2005, 52:501-513.30. Tokunaga M, Fujii K, Saito K, Nakayamada S, Tsujimura S, NawataM, Tanaka Y: ... results,according to the following equation:ResultsClinical characteristics of the patients and response to rituximab therapyThe clinical and laboratory characteristics of the RA patientswho...
- 8
- 376
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ