Báo cáo y học: "Duodenal enteroglucagonoma revealed by differential comparison of serum and tissue glucagon reactivity with Siemens'''''''' Double Glucagon Antibody and DakoCytomation''''''''s Polyclonal Rabbit Anti-Human Glucagon: a case report" ppsx

... this article as: Vanderlan et al., Duodenal enteroglucagonoma revealed by differential comparison of serum and tissue glucagon reactivity with Sie- mens' Double Glucagon Antibody and DakoCytomation's ... differential comparison of serum and tissue glucagon reactivity with Siemens' Double Glucagon Antibody and DakoCytomat...

Ngày tải lên: 11/08/2014, 12:20

... recovery was une- ventful, and the patient was discharged on postoper- ative day 4. Fig.1 Fluid collection and left ovary cyst was noted on computed tomography. The size of ovary cyst was 2.0 ... of a monolayer of inner circular muscle, which makes its wall weak, as com- pared to the small intestine that is formed of the inner circular and outer longitudinal muscle lay...

Ngày tải lên: 25/10/2012, 10:51

... luteal area with radiati on to the proximal posterior thigh. Pain was aggravated by sitting and squatting. MRI examination at that time revealed an extensive hematoma extending to both the quadratus femoris ... injury. The immediate and correct diagno- sis is a challeng e because of its rarity and similarities to other disorders that cause groin pain. Only a few cases of p...

Ngày tải lên: 11/08/2014, 03:21

... (elevated heart rate and arterial blood pressure ); exacerbation of anxiety; and activation of the hypothalamic-pituitary-adrenal axis. The most frequently reported side effects are arrhythmias, hyperthermia, ... 40(3):395-404. doi:10.1186/1752-1947-4-240 Cite this article as: Gama et al.: Diabetic ketoacidosis complicated by the use of ecstasy: a case report. Journal of Med...

Ngày tải lên: 11/08/2014, 03:21

... our case) with a female to male ratioof6:1.Theageofpatientsrangesfrom17to43 years with an average a ge of 29.6 years. The symptoms were hip pain in three patients, gr oin pain in one pati ent and ... was obtained from the patient for publication of this case report and any accompany- ing images. A copy of the written consent is available for review by the Editor-in-Ch...

Ngày tải lên: 11/08/2014, 07:20

... 40(3):395-404. doi:10.1186/1752-1947-4-240 Cite this article as: Gama et al.: Diabetic ketoacidosis complicated by the use of ecstasy: a case report. Journal of Medical Case Reports 2010 4:240. Gama et al. Journal of Medical Case Reports ... sexual arousal, the drug was later used as an adjunct to psychotherapy. In the1980s,MDMAbecameatrendydrugofabuse,par- ticularly at rave p...

Ngày tải lên: 11/08/2014, 07:20

... regions b  Δ G c  RB14 UUUUAAUUUAUAAAUACCUCCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU -18.9 RB69 UCCUAUAAGUAAUAAAUACCUCCUAUAAACGUGGGAGGUAUUAUGAAUAUAUUU -16.3 T4, others UUUAAUUUUAUAAAUACCUUCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU -14.7 CC31 GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU -12.2 ... CC31 GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU -12.2 CUUAGGAGGUAUUAUGAAUA...

Ngày tải lên: 11/08/2014, 21:21

... Mode of administration Status Company Age-related macular degeneration (AMD) Topical Phase II Allergan Respiratory syncytial virus (RSV) Local/direct Phase II Alnylam Liver cancer (HCC and others) ... from capped, polyadenylated transcripts that can also function as mRNAs. RNA 2004, 10:1957-1966. 45. Chung KH, Hart CC, Al Bassam S, Avery A, Taylor J, Patel PD, et al: Polycistronic RNA po...

Ngày tải lên: 12/08/2014, 01:22

... only the novel data: protonation constants for DAHKam and VIHN, and stability constants (log a values) of Cu(II)-VIHN, Cu-DAHKam and Ni-DAHKam systems. The parameters of CD and EPR spectra of all major ... Bal 1,2 1 Faculty of Chemistry, University of Wroclaw, Poland; 2 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland A comparati...

Ngày tải lên: 22/02/2014, 04:20

... data for a more easily accessible tissue such as skin for this exon array publicly available; however, one can extrapolate that adding cDNA from almost any tissue would be similarly beneficial ... We found that at only one lane of RNA-Seq data, the specific- ity was 0.5 for SNVs with a read depth of 3, which was far better than the value of 0.28 found when using all eight lane...

Ngày tải lên: 09/08/2014, 20:22