Báo cáo y học: "Five-year follow-up of Japanese patients with Paget''''''''s disease of the bone after treatment with low-dose oral alendronate: a case series/" ppt
Báo cáo y học: "Assessing post-traumatic stress disorder in South African adolescents: using the child and adolescent trauma survey (CATS) as a screening tool" docx
... imperative that parental collateral be obtained. Previous studies have noted that parents may not always be aware of what their children are experiencing and may, therefore, not always be accurate ... of Child and Adolescent Psychiatry: Practice parameters for the psychiatric assessment of children and adolescents. Journal of the American Academy of Child and Adolescent Psychiat...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Possible gabapentin and ketamine interaction causing prolonged central nervous system depression during post-operative recovery following cervical laminoplasty: a case report" potx
... pain. Gabapentin is structurally related to gamma-aminobuty- ric acid (GABA), a neurotransmitter that plays an important role in neuronal excitability. The exact mechanism by which gabapentin ... describe a case in which, after implantation of a spinal cord stimulator, a 42-year-old woman presented with quadriplegia and lower facial diplegia. She was able to open and blink h...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Five-year follow-up of Japanese patients with Paget''''s disease of the bone after treatment with low-dose oral alendronate: a case series/" ppt
... this article as: Iba et al., Five-year follow-up of Japanese patients with Paget's disease of the bone after treatment with low-dose oral alendronate: a case series Journal of Medical Case ... follow- up of patients with PDB after a six-month treatment with low-dose oral alendronate (5 mg per day). Case presentation Case 1 A...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"
... its services. Authors' contributions MK had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. MK contributed ... design, analysis of results, interpretation of findings, and drafting of the paper. Independent statistical analysis. The accuracy of the data analysis was...
Ngày tải lên: 25/10/2012, 10:02
Tài liệu Báo cáo Y học: Dnmt3a and Dnmt1 functionally cooperate during de novo methylation of DNA pdf
... interaction of the catalytic domain with the N-terminal part of the enzyme leading to an allosteric activation of the enzyme after binding to methylated DNA. J. Mol. Biol. 309, 1189–1199. 19. Bacolla, A. , ... additional DNA binding site in its N-terminal part [33]. The observation that Dnmt 3a is not activated by pre-exiting methylation agrees with the fact that th...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf
... between both assays is the coupling of AR.NTD to GalAD in the yeast assay, and the absence of a second transactivation domain linked to AR NTD in the mammalian assay. The latter assay completely depends ... 5¢- AATTCGGGGCCCGGGTTCTGGATCACTTCGCGCACGCTCTGGAACAGATTCTG-3¢ pr172B 5¢- CGGAGCAGCTGCTTAAGCCGGGG-3¢ pr-242 5¢- AAGCTTCTGCAGGTCGACTCTAGG-3¢ PDsense 5¢- GATCCATATCGATAAGCTTAGA...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... broad range of bacterial species. The polysaccharides often constitute the outermost layer of the cell, and have been implicated as an important factor in the virulence of many animal and plant ... Faculty of Dental Science, Fukuoka, Japan; 3 Department of Oral Health, Nihon University School of Dentistry, Tokyo, Japan The serotype a- specific polysaccharide antigen o...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Brassica napus soluble epoxide hydrolase (BNSEH1) Cloning and characterization of the recombinant enzyme expressed in Pichia pastoris docx
... all subsequent analysis. The sEH activity in the cells increased rapidly after addition of methanol and cells were usually harvested after four days of culture. After several passages of the yeast cells ... and assayed for enzyme activity and absorbance at 280 nm. Catalytic characterization of recombinant BNSEH1 Epoxide hydrolase activity was assayed based on conversion o...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Platelet-Activating Factor Antagonists Decrease Follicular Dendritic-Cell Stimulation of Human B Lymphocytes" pptx
... lym- phocytes that have a high affinity for the antigen are selected, and these are allowed to further develop in a process known as affinity maturation. The surfaces of FDCs display other accessory molecules, ... to B lymphocytes, FDCs, or the combination of B lymphocytes and FDCs at the initiation of cul- ture, and supernatants were harvested after 7 days of incubation...
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "Self-reported asthma and allergies in top athletes compared to the general population - results of the German part of the GA2LEN-Olympic study 2008" pptx
... shown that prevalence of asthma and allergie s reached a pla- teau. As we had to rely on self-reported data it might also be that the reported respiratory symptoms of the athletes during and/or after ... athletes are available. Therefore, one aim of th e study was to assess the preva- lence of allergic and respiratory diseases and informa- tion about medical treatment in G...
Ngày tải lên: 08/08/2014, 21:20