báo cáo khoa học: " Structure, expression differentiation and evolution of duplicated fiber developmental genes in Gossypium barbadense and G hirsutum" ppsx
báo cáo khoa học: " Structure, expression differentiation and evolution of duplicated fiber developmental genes in Gossypium barbadense and G. hirsutum" ppsx
... Access Structure, expression differentiation and evolution of duplicated fiber developmental genes in Gossypium barbadense and G. hirsutum Huayu Zhu, Xiaoyong Han, Junhong Lv, Liang Zhao, Xiaoyang ... EF363689 calcineurin B-like (CBL) protein-interacting protein kinases, was highly expressed in the elongating phase in developing fiber Exp1 DQ204495 alpha-exp...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt
... ** *G* ******C*********TG *G* G** *G* *A**A******** ZF9 +145 M GCGCTCGGGGTGGCCCAAGCGGGCGG CCCCAGGCCGGCCAGCGCGGT CAGTGGGACGCCGGGGAGAGCCGGAGAA CGAAGCGGGCCTG H ****C****C****GG*GA************C**** *G* CAG****GGCTCG *G* GA****C*A*T*A******T *G* **GGGG** *G* *TC** *G* CGG ... ****C****C****GG*GA************C**** *G* CAG****GGCTCG *G* GA****C*A*T*A******T *G* **GGGG** *G* *TC** *G* CGG MZF1 WHZ...
Ngày tải lên: 16/03/2014, 18:20
Tài liệu Báo cáo khoa học: nsights into the reaction mechanism of glycosyl hydrolase family 49 Site-directed mutagenesis and substrate preference of isopullulanase doc
... CCTGGTtcCATAAC ACCGGtGAAATC AgeI W240F GGTGCT gAGCTCAAGTGTGACTTtcGTCTAC SacI W402F CCGGTG GTcGAcTTTGGTTtcACGCCC SalI E273Q ACGTACTGCTgTCCGGAA AGtACtCCATGGCCGC ScaI D353N TCCAATCCGTtAGTC TGgCCaTAGAACGCGC MscI E356Q ... TCCAATCCGTtAGTC TGgCCaTAGAACGCGC MscI E356Q GGAGAAT GGTgCCAGGGTACATTTcCAATCCGTCA KpnI D372N AATACAT CTTaAGGCCGTCGTtGTCGGTGTGG AflII D373N AATACAT CTTaAGGCCGTtGCGTCGGTG AflII Ó FEB...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... sequence of 75-mer oligonucleotide is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢. [ 3 H]dTTP (10 l M ;10CiÆmmol )1 ) and enzymes were added as indicated in ... agreement between the original distance matrix and that obtained directly from the dendrogram. Pol k was confirmed to be highly conserved among the plant and animal kingdoms (Fig. 1B),...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Multidrug efflux pumps: The structures of prokaryotic ATP-binding cassette transporter efflux pumps and implications for our understanding of eukaryotic P-glycoproteins and homologues ppt
... Holy Grails of ATP-binding cassette transporter research is a structural understanding of drug binding and transport in a eukaryotic multidrug resistance pump. These transporters are front-line ... validation against bioinformatics data using the principle of residue co -evolution, i.e. the extent to which evolution of a residue i in a given protein is coupled to evolution...
Ngày tải lên: 22/03/2014, 21:20
báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt
... indicated also previous symptoms in the last two years of maxillary sinusitis including tenderness in the left infraorbital region and nasal stuffiness. Clinical examination identified pain in ... maxillary sinusitis includ- ing tenderness in the left infraorbital region and nasal stuffiness. In this case a small bone window in the lateral wall of the maxillary sinus was p...
Ngày tải lên: 11/08/2014, 23:22
báo cáo khoa học:" Assessing the Stroke-Specific Quality of Life for Outcome Measurement in Stroke Rehabilitation: Minimal Detectable Change and Clinically Important Difference" pdf
... intervention groups for clinimetric analyses. The current investigation has some limitations that warrant consideration when interpreting and generaliz- ing the study findings. First, the generalizability ... the ranges of minimal CIDs. The percentage of scale width was calculated by dividing the MDC and CIDs by the total score range of each physical category. The percentage of pa...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo khoa học: Evolutionary changes to transthyretin: evolution of transthyretin biosynthesis doc
... [18]. In the light of reports of decreased transthyretin synthesis and secretion in the brains of ageing mammals [45], the role of transthyretin in the ageing brain requires further investigation. Visceral ... trans- thyretins in terms of ligand preference and strength of binding. For this reason, it would be interesting to analyse the distribution of deiodinases in...
Ngày tải lên: 07/03/2014, 00:20
báo cáo khoa học: " Intein-mediated site-specific conjugation of Quantum Dots to proteins in vivo" pdf
... PCR fragment amplified with IGpr62 (TGTACAG- GCGCGCGTACGGCGGCGGCGGCGGCGGC AAGTTT- GCGGAATA TTGCCTCAG) and IGpr64 (CGCGCG GC GGCCGCTTATTTAATTGTCCCAGCG) encoding I N with 5 N-terminal extein residues ... A PCR fragment amplified with IGpr61 (AAGGAATTCAAGTTT- GCGGAATATTGCCTCAGTTTTGG) and IGpr63 (AAGC TCGAGTTATTTAATTGTCCCAGCG) encoding I N with 5 N-terminal extein residues (KFAEY), using th...
Ngày tải lên: 11/08/2014, 00:22
báo cáo khoa học: " Multiple evidence for the role of an Ovate-like gene in determining fruit shape in pepper" pptx
... through VIGS in cv. “Round” changes its fruit to a more oblong form indicating that CaOvate is indeed involved in determining fruit shape in pepper, perhaps by negatively affecting the expression ... understand the molecular mechanisms involved in controlling fruit shape in Solanaceae plants in general, and pepper in particular, as well as the changes in fruit quality in...
Ngày tải lên: 11/08/2014, 11:21