báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps
... RESEARCH ARTICLE Open Access Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits Sarah ... this article as: Danan et al.: Construction of a potato consensus map and QTL meta-analysis offer new insights into the...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
... molecular characterizations of PVM isolates. HX designed and coordinated the study and carried out the genetic analysis. All authors read and approved the final manuscript. Competing interests The authors ... into twodistinctgroups-groupIandII.GroupIconsisted of PVM isolates detected and characterized in Italy, Ger- many, China, Poland and Russia and group I I cons...
Ngày tải lên: 12/08/2014, 04:21
báo cáo khoa học: " Cannabis as a substitute for alcohol and other drugs Amanda Reiman" pps
... investigate medical cannabis as a treatment for alcohol and/ or drug dependence. The survey data were collected by the researcher at BPG. The researcher approached patients as they came into BPG and asked ... T: Cannabis as a substitute for alcohol: A harm- reduction approach. Journal of Cannabis Therapeutics 2004, 4:79-93. 14. Reiman A: Patient Profiles: Medical cannabis...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo Y học: Dietary bisphenol A prevents ovarian degeneration and bone loss in female mice lacking the aromatase gene (Cyp19 ) pptx
... 5¢-GCAAGAGCAGGCA CCCAGCAACCAG-3¢ and antisense primer: 5¢-TTCCGT CACATAAAACCACAGCACT-3¢), follicle stimulating hormone (FSH) receptor (a 684-bp fragment with sense primer: 5¢-TAGATGATGAACCCAGTTATGGAA-3¢ and ... from Oriental Yeast (Tokyo, Japan). BPA and E2 were from Sigma-Aldrich. An ELISA kit for BPA was from Takeda Pharmaceutical Co. Ltd. (Tokyo, Japan). All other chem- icals were...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 GGAGCCATAATGACAGCAGT Detection system ... GCCCGTCGACATATTATATATATATATAGG 2 CCCGCTCGAGTCTTAGAATTATTGAGAACG 3 GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... Burlington, Ontario, Canada) and by shearing through an 18G needle, as previously described [28]. The isolated DNA was extracted with phenol and chloroform, precipitated with ethanol and Na-acetate, and ... Central Hospital Research and Education Fund, The Maud Kuistila Memorial Foundation, The Finnish Foundation for Research on Viral Diseases, and the Medical Society of...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx
... characterization of a bovine BAC library with four genome-equivalent coverage André E GGEN a, ∗ , Mathieu G AUTIER a , Alain B ILLAUT d , Élisabeth P ETIT a , Hélène H AYES a , Pascal L AURENT a , Catherine ... estimate the quality of the library. 2. MATERIAL AND METHODS 2.1. DNA preparation A cell line derived from the genital ridge of a male fœtus from a high...
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L.)" docx
... Yoshikawa M, Taketa M, Hay- ashi M, Pedrosa A, Onda R, Imaizumi-Anraku H, Bachmair A, Sandal N, Stougaard J, Murooka Y, Tabata S, Kawasaki S, Kawaguchi M, Harada K: Construction of a genetic linkage ... developed. These maps are generally constructed with the aim of determining the relative position of trans- ferable markers, increasing the number of available DNA marker...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... terms of standardisation, full audit trail, legibility, use of approved names, specification of key data fields such as route of admin- istration, storage and recall of records. Although the CPOE ... critically revising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis, interpretation and drafting the manus...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... trifluoroacetic acid) at a 1 : 1 ratio and 1 lLof mixture applied directly to the sample plate. The droplet was air-dried before analysis in the MS. MALDI spectra were obtained in reflectron mode and a nitrogen ... d 1 heme lacking iron and ⁄ or with the side chain satu- rated, but accessing these putative substrates is not trivial. An alternative approach would be to seek acc...
Ngày tải lên: 15/02/2014, 01:20