báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

... RESEARCH ARTICLE Open Access Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traitsSarah ... this article as: Danan et al.: Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits. ... dditional file 1 and on the SGN database [37]. QTL dataset for meta-analysis On the basis of the 19 publications of QTL studies, a total of 211 late blight resistance QTLs and 64 matur-ity QTLs...

Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

... molecular characterizations of PVM isolates. HX designed and coordinated the study and carried out the genetic analysis. All authors read and approved the final manuscript.Competing interests The authors ... into twodistinctgroups-groupIandII.GroupIconsisted of PVM isolates detected and characterized in Italy, Ger-many, China, Poland and Russia and group I I consisted of Canadian and US isolates. Isolates in group I mightbe further divided into ... PVM3 and PVM4, a NcoI si te wasrevealed in PVM isolates detected in Germany, Italy,Russia, Poland and China, but not found in the isolatesdetected in the US ( Idaho strain) and Canada (data notshown).Table...

báo cáo khoa học: " Cannabis as a substitute for alcohol and other drugs Amanda Reiman" pps

... investigatemedical cannabis as a treatment for alcohol and/ or drugdependence. The survey data were collected by the researcher at BPG. The researcher approached patients as they came into BPG and asked ... T: Cannabis as a substitute for alcohol: A harm-reduction approach. Journal of Cannabis Therapeutics 2004,4:79-93.14. Reiman A: Patient Profiles: Medical cannabis patients and health care ... Reduction JournalOpen AccessResearchCannabis as a substitute for alcohol and other drugsAmanda ReimanAddress: School of Social Welfare, University of California, Berkeley, 120 Haviland Hall, Berkeley,...

Báo cáo Y học: Dietary bisphenol A prevents ovarian degeneration and bone loss in female mice lacking the aromatase gene (Cyp19 ) pptx

... 5¢-GCAAGAGCAGGCACCCAGCAACCAG-3¢ and antisense primer: 5¢-TTCCGTCACATAAAACCACAGCACT-3¢), follicle stimulatinghormone (FSH) receptor (a 684-bp fragment with senseprimer: 5¢-TAGATGATGAACCCAGTTATGGAA-3¢ and ... fromOriental Yeast (Tokyo, Japan). BPA and E2 were fromSigma-Aldrich. An ELISA kit for BPA was from TakedaPharmaceutical Co. Ltd. (Tokyo, Japan). All other chem-icals were of analytical grade.AnimalsAnimal ... repeated a series of the experiments and obtained essentially same results.Preparation and analysis of RNAUteri and ovaries were collected from each mouse and usedfor preparation of total RNA...

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 GGAGCCATAATGACAGCAGTDetection system ... GCCCGTCGACATATTATATATATATATAGG2 CCCGCTCGAGTCTTAGAATTATTGAGAACG3 GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 ... CCCCGCGGCCGCTGACACCGATTATTTAAA16 TTTTGAGCTCGGAGCCATAATGACAGCAGT17 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20...

Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

... Burlington,Ontario, Canada) and by shearing through an 18G needle,as previously described [28]. The isolated DNA wasextracted with phenol and chloroform, precipitated withethanol and Na-acetate, and ... Central HospitalResearch and Education Fund, The Maud KuistilaMemorial Foundation, The Finnish Foundation forResearch on Viral Diseases, and the Medical Society of Finland (Finska La¨karesa¨llskapet).References1 ... numbering accord-ingly), and found to be 3748 nucleotides in length. A TATA-box (TATAA) was located at nucleotides 83–87 and a poly (A) sequence ATTAAA at nucleotides2978–2983. A GC-rich area was 107...

Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx

... characterization of a bovine BAC library with fourgenome-equivalent coverageAndré EGGEN a, ∗, Mathieu GAUTIER a ,Alain BILLAUTd, Élisabeth PETIT a , Hélène HAYES a ,Pascal LAURENT a , Catherine ... estimate the quality of the library.2. MATERIAL AND METHODS2.1. DNA preparation A cell line derived from the genital ridge of a male fœtus from a high rankingholstein bull was used to prepare ... in BAC libraries is around 28. Added to the bovineYAC, ovine BAC [10] and goat BAC [8] libraries hosted at Inra, this gives a 15 genome-equivalent coverage of the ruminant genomes available...

báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L.)" docx

... Yoshikawa M, Taketa M, Hay-ashi M, Pedrosa A, Onda R, Imaizumi-Anraku H, Bachmair A, SandalN, Stougaard J, Murooka Y, Tabata S, Kawasaki S, Kawaguchi M,Harada K: Construction of a genetic linkage ... developed. These maps are generally constructedwith the aim of determining the relative position of trans-ferable markers, increasing the number of available DNAmarkers, obtaining saturated maps and ... Plants and Animals' program".References1. Sato S, Isobe S, Asamizu E, Ohmido N, Kataoka R, Nakamura Y,Kaneko T, Sakurai N, Okumura K, Klimenko I, Sasamoto S, Wada T,Watanabe A, ...

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... terms of standardisation, full audit trail, legibility, use of approvednames, specification of key data fields such as route of admin-istration, storage and recall of records.Although the CPOE ... criticallyrevising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis,interpretation and drafting the manuscript.AcknowledgementsTo the Medical ... Bates DW: Pharmacist participation on physician rounds and adverse drug events in the intensive care unit. JAMA1999, 282:267-270.16. British Medical Association and the Royal Pharmaceutical...

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... triﬂuoroacetic acid) at a 1 : 1 ratio and 1 lLofmixture applied directly to the sample plate. The dropletwas air-dried before analysis in the MS. MALDI spectrawere obtained in reﬂectron mode and a nitrogen ... d1heme lacking iron and ⁄ or with the side chain satu-rated, but accessing these putative substrates is nottrivial. An alternative approach would be to seek accu-mulation of the substrate of NirF ... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA...

Xem thêm