báo cáo khoa học: " HvCEBiP, a gene homologous to rice chitin receptor CEBiP, contributes to basal resistance of barley to Magnaporthe oryzae" ppt
báo cáo khoa học: " HvCEBiP, a gene homologous to rice chitin receptor CEBiP, contributes to basal resistance of barley to Magnaporthe oryzae" ppt
... analysis. HK participated in cytological analysis of barley infection assay. MM participated in barley gene silencing and data analysis, TN participated in barley infection assay and data analysis. ... 20:471-481. doi:10.1186/1471-2229-10-288 Cite this article as: Tanaka et al.: HvCEBiP, a gene homologous to rice chitin receptor CEBiP, contributes to basal r...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt
... 5¢-CGTCCG CGT GCAAACGTGG and 5¢-CCACGTTTGCACGCGG ACG for P20 2A (pHO380), 5¢-CGCCGTCCGCGTCCA GCTGTGGCGGAAGTCATGAATATTGTAGGTAACATC GAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTC ATGACTTCCGCCAC AGCTGGACGCGGACGGCG ... for N20 3A (pHO392), 5¢-CGCCGTCCGCGTCCAAAC GCCG CGGAAGTCATGAATATTGTAGGTAACATCGAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTCATGACT TCCGC GGCGTTTGGACGCGGACGGCG for V20 4A (pHO393), 5¢-CGTGGCG G...
Ngày tải lên: 23/03/2014, 15:20
báo cáo khoa học: "Adenovirus-mediated siRNA targeting Bcl-xL inhibits proliferation, reduces invasion and enhances radiosensitivity of human colorectal cancer cells" ppt
... survival in 4 sense:5’-GATCCCCGGAGATGCAGGTATTGGTGttcaagagaCACCAATACCTGCATCTCCTTTT- TGGAAA-3’; Negative control shRNA, sense: 5’-GATCCCCGGTGAGAGGTAGGCGTTTAttcaa- gagaTAAACGCCTACCTCTCACCTTTTTGGAAA-3’; ... Shinomura Y, Kanayama S, Higashimoto Y, Miyagawa JI, Minami T, Kiyohara T, Zushi S, Kitamura S, Isozaki K, Matsuzawa Y: Over-expression of bcl-xL gene in human gastric adenomas and...
Ngày tải lên: 09/08/2014, 02:21
Báo cáo khoa học: " Chemotherapy followed by low dose radiotherapy in childhood Hodgkin''''s disease: retrospective analysis of results and prognostic factors" ppt
... medi- astinal lymphadenopathy (defined as the ratio of medias- tinal mass to intra-thoracic cavity of one third or greater on upright chest radiograph, or a peripheral lymph node mass greater than ... analysis of significant factors. (p < 0.05) Characteristics of patients and treatment Demographic characteristics of the patient cohort are shown in Table 1. The median age was...
Ngày tải lên: 09/08/2014, 10:21
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... 88, 12–19. 19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004) Identification of the first archaeal type 1 RNase H gene from Halobacterium sp. NRC-1: archaeal RNase HI can cleave an RNA-DNA junction. ... phosphatase domain Naoto Ohtani 1 , Natsumi Saito 1 , Masaru Tomita 1 , Mitsuhiro Itaya 1,2 and Aya Itoh 1 1 Institute for Advanced Biosciences, Keio University, Tsuruoka, Yamagata, Japa...
Ngày tải lên: 19/02/2014, 18:20
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt
... PO & Matthews RG (2002) Adaptation to famine: a family of stationary-phase genes revealed by microarray analysis. Proc Natl Acad Sci USA 99, 13471–13476. 30 Glatz A, Horva ´ th I, Varvasovszki ... plant starch granule. Annu Rev Plant Biol 54, 207–233. 8 Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hirosawa M, Sugiura M, Sasamoto S et al. (1996) Sequence...
Ngày tải lên: 16/03/2014, 04:20
báo cáo khoa học: "Effet du gène Na (cou nu) chez des coqs élevés à deux températures I. Croissance, consommation alimentaire et" pps
... w1 h 0" alt =""
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: "Effet du gène Na (cou nu) chez des coqs élevés à deux températures II. Caractéristiques du sperme et reproduction" pdf
... cocks each (4 pools per genotype and treatment) biochemical parameters of seminal plasma or of spermatozoa were measured. A reduction of the age at first ejaculate and a decrease ... travail s’accordent avec des données antérieures citées en introduction : c’est le cas de l’avancement de l’âge au l er éjaculat (en accord avec I NGKASUWAN...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: "Effets du gène « crête en pois » et d’autres gènes à effet visible sur le poids des coqs adultes" ppsx
... uniquement d’un écart dans la croissance tardive, précédant ou suivant la maturité sexuelle. Par ailleurs, il paraît peu vraisemblable que le gain de poids tardif plus élevé ... données complémentaires, son niveau de signification (P < 0,05) n’excluant pas qu’il puisse apparaître par hasard sur les 8 comparaisons du tableau. Par contre, il...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc
... Genevestigator V3 [39] anatomy clustering tool. At the time of analysis, the Genevestigator database totalled 374 publicly available microarray studies for Arabidopsis, encompassing 6290 samples. ... 17:2281-2295. 48. Sato K, Suzuki R, Nishikubo N, Takenouchi S, Ito S, Nakano Y, Nakaba S, Sano Y, Funada R, Kajita S, Kitano H, Katayama Y: Isolation of a novel cell wall architecture...
Ngày tải lên: 11/08/2014, 11:21