báo cáo khoa học: " Characterization of singlet oxygen-accumulating mutants isolated in a screen for altered oxidative stress response in Chlamydomonas reinhardtii" ppsx

báo cáo khoa học: " Characterization of singlet oxygen-accumulating mutants isolated in a screen for altered oxidative stress response in Chlamydomonas reinhardtii" ppsx

báo cáo khoa học: " Characterization of singlet oxygen-accumulating mutants isolated in a screen for altered oxidative stress response in Chlamydomonas reinhardtii" ppsx

... 10:279 http://www.biomedcentral.com/1471-2229/10/279 Page 7 of 13 RESEARC H ARTIC L E Open Access Characterization of singlet oxygen-accumulating mutants isolated in a screen for altered oxidative stress response in Chlamydomonas reinhardtii Beat ... article as: Fischer et al.: Characterization of singlet oxygen- accumulating mutants isolated in...

Ngày tải lên: 11/08/2014, 11:21

13 220 0
Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx

Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx

... lgofproteineach)obtained from the indicated organs were subjected to immunoblotting analysis using anti-(Ubi-L) Ig as well as anti-(Bcl-G) Ig. Molecular mass is shown in kDa. Anti-actin Ig was ... phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91, 231–241. 21. Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yok...

Ngày tải lên: 17/03/2014, 10:20

7 272 0
Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

... Germany). The radioactivity was quantified in a Canberra-Packard Tricarb-2500 counter. The kinetic constants of transport were estimated using the method of Hanes. All data represent means of at least three ... Glc6P can be transported by a molecule that is locked in the inducing conformation and which argues against the transport of Glc6P causing an inducing conformation. For...

Ngày tải lên: 08/03/2014, 08:20

8 412 0
báo cáo khoa học: " Impact of welfare cheque issue days on a service for those intoxicated in public" pptx

báo cáo khoa học: " Impact of welfare cheque issue days on a service for those intoxicated in public" pptx

... hospital inpatients leav- ing a specialized HIV inpatient ward AMA [7] and a decrease in occupancy rate to a medical withdrawal man- agement [8]. This study is designed to rigorously examine the ... Evaluation and Outcome Sciences, Vancouver, Canada, 3 Vancouver Coastal Health, Vancouver, Canada and 4 Providence Health Care, Vancouver, Canada Email: Xin Li - xin@hivnet.ubc.ca; Huiy...

Ngày tải lên: 11/08/2014, 18:20

4 277 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 Dipartimento di ... control and irradiated samples were significant for MCF-7 cells at all time intervals examined. On the other hand, statistical significance for HeLa samples was observed at days 2 and 3 after irradi...

Ngày tải lên: 18/02/2014, 13:20

14 765 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-CTTCCTCCGCTTCCATGA-3¢) and QaCgClp1 (5¢-CCATGAAGTCCGCGAATC-3¢); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, ... CHRK1, a chitinase-related receptor-like kinase, plays a role in plant development and cytokinin homeostasis in tobacco. Plant Mol Biol 53, 877–890. 7 Kawamura K, Shibata T, Saget O...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... Kominato Y, Yamamoto F & Takizawa H (2002) Characterization of the human ABO gene pro- moter in erythroid cell lineage. Vox Sang 82, 39–46. 34 Yasuda T, Awazu S, Sato W, Iida R, Tanaka Y & Kishi ... corresponding to the amplified products A and H, can be translated to produce intact DNase I protein. By contrast, 3¢-RACE using total RNA from QGP-1 cells and pancreas as a templ...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... mediators involved is missing for most of these signals [1,2]. Plant genomes contain a large family of PM H + - ATPase genes (12 in Arabidopsis thaliana, 10 in rice and nine in Nicotiana plumbaginifolia), ... clones isolated previously [22] using the following primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCT...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... is indicated in red, the pro-region in black, catalytic domain in blue and the C-terminal domains in violet. The assumed start of the second C-terminal domain is indicated with a black arrow. A. ... vector (Invitrogen). PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTG...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH 5¢- CATATGACTGGAGACTTTAAGATC P2Z 5¢-TAT GGATCCTCACCACCCAATTTCGGAAAG P2ZH ... stand for Sno1p, Snz1p and His-tag, respectively. Underlined are the restriction enzyme sites. Primer Sequence P1O 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CATATGCACAAAACCCACAGTAC P2O 5¢...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Từ khóa:
w