báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa tttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and dedu...

Ngày tải lên: 11/08/2014, 11:21

... knowledge of their functions. Studies to understand host resistance mechan- isms in maize and peanut against A. flavus infection and aflatoxin contamination indicate that proteins are a major factor ... designing the real time PCR primers and data analysis. LL participated in conceiving the study and material preparation. XL participated in conceiving the study, data anal...

Ngày tải lên: 11/08/2014, 11:21

... ECL film (Amersham, USA). As a control, VOPBA of TGEV was performed in porcine enterocytes using the same method as VOPBA of PEDV. To detect the binding of PEDV to pAPN, direct virus- binding studies ... human and porcine coronaviruses, respectively [29]. These facts lead to the speculation that PEDV may gain entry into the enterocytes through APN which is an 150 kDa...

Ngày tải lên: 07/08/2014, 17:22

... Mexican origin. The index case was a 23-year-old female diagnosed with breast carci- noma of the left breast with combined histological fea- tures of lobular carcinoma and infiltrating ductal carcinoma. ... sarcoma, osteosarcoma, brain tumor, pre-menopausal breast cancer, adrenocortical car- cinoma, leukemia, lung bronchioloalveolar carcinoma) prior to the age of 46 years and...

Ngày tải lên: 09/08/2014, 04:21

... Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, Yamamoto T, Lin SY, Antonio BA, Parco A, et al: A high-density rice genetic linkage map with 2275 markers using a single F2 population. ... which are all very similar in essence: Introgression Lines (ILs) in tomato [11]Brassica napus [16] and Brassica oleracea [17], Stepped Aligned Inbred Recombinant Strains (STAIRS) in...

Ngày tải lên: 12/08/2014, 03:21

... (LG0053: 5'-GAACTCATGCAACT- TACCCAGC-3' and LG0052: 5'-GCCAAGACATGATC- CAACGG-3') designed to the 3D region of the genome. None of these samples were positive for the presence of HCoSV-E1. ... struc- tured and contain an internal ribosome entry site (IRES) that directs translation of the RNA by internal ribosome binding [11]. The 3'-non-translated...

Ngày tải lên: 12/08/2014, 04:21

... analysis of the data and drafting and editing of the manuscript. All authors read and approved the final man- uscript. Acknowledgements The authors are grateful to Ian Jones (University of Reading) ... maintaining fitness in the viral population [1]. Mutation in vivo can have a number of effects including increasing the virulence of a virus [2] or acquisition...

Ngày tải lên: 12/08/2014, 04:20

... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Taka- hashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, Fujitsuka ... TU in whole* 2 Lift ATCIS Description ACACAC 10 6056 1.353 PRHA BS in PAL1* 3 ATACACA 5 2124 1.929 PRHA BS in PAL1 ATACACAC 3 739 3.326 PRHA BS in PAL1 TACACAC 4 1786 1.835 PRHA...

Ngày tải lên: 12/08/2014, 05:20

... made. Leaf area ratio (LAR; m2 ·g-1 ) was cal- culated as the ratio of total leaf area to plant dry weight; specific leaf area (SLA; m2 ·g-1 ) was calculated as the ratio ... that total plant leaf area increased mainly as a result of accelerated ontogeny [48]. With time, it would be expected that the advantage of overall higher RGR...

Ngày tải lên: 08/08/2014, 14:21

... resulting in an approximately seven- fold increase in the total amino acid content. The expression of the AS gene, encoding a transaminase responsible for the synthesis of asparagine from aspar- tate ... Imai A, Akiyama T, Kato T, Sato S, Tabata S, Yamamoto KT, Takahashi T: Spermine is not essential for survival of Arabidopsis. FEBS Letters 2004, 556:148-152. 39. Imai A,...

Ngày tải lên: 11/08/2014, 11:21