báo cáo khoa học: " Habituation to thaxtomin A in hybrid poplar cell suspensions provides enhanced and durable resistance to inhibitors of cellulose synthesis" potx

... endohydrolase, a polygalacturonase, a pectinesterase, two expansins and a lyase. Expression data in TA(-)hab cells was compared to that of Arabidopsis IXBhab cells [32] using matching AGIs (Additional ... staining in the cell wall s of TA(-)hab cells com- pared to a very faint staining in control cells, also sug- gesting the accumulation of more pectins in the c...

Ngày tải lên: 11/08/2014, 11:21

... Savant Our retrieval goals in IR are often affective in na- ture: we want to find a way of speaking about a topic that expresses a particular sentiment and car- ries a certain tone. However, affective ... on Creating and Using Se- mantics for Information Retrieval and Filtering. Ca- nary Islands, Spain, May 2002. Navigli, R. and Velardi, P. (2003). An Analysis of On-...

Ngày tải lên: 07/03/2014, 22:20

... FZ and CTH participated in data acquisition and literature review. MB, JD and PEH participated in drafting the manuscript and revised it critically. All authors read and approved the final manuscript. Table ... descendostoma. Treatment toxicity Acute toxicity related to the radiation treatment was of minor grade in all cases. No acute toxicity of grade > 1 according...

Ngày tải lên: 09/08/2014, 08:22

... revealed that CPR consists of an N-terminal membrane anchor, respon- sible for its localization to the endoplasmic reticulum, and three folded domains: an FAD- and NADPH-binding domain related to ... ferredoxin-NADP + reductase, a flavo- doxin-like FMN-binding domain and a connecting ÔlinkerÕ domain. In addition to the cytochromes P450, CPR can donate electrons to cytochr...

Ngày tải lên: 23/03/2014, 17:22

... 2) information, including the dis- tributing information about ACA, making the business case for ACA and transition materials; 3) communication of general and technical information about ACA by ... behavioral control' was assessed with three items that asked if the team was able to adapt ACA to meet their clinic needs, and about the extent of influence in manag- ing care...

Ngày tải lên: 11/08/2014, 16:21

... resulted in the accumulation of both salicin and iso- salicin (hereafter referred to as salicins). In all cases, accu- mulation of salicins reached a plateau by 48 hr (Fig. 2), and was higher with salicin ... five cell wall invertases (CIN), three vac- uolar invertases (VIN), and sixteen cytosolic neutral/alka- line invertases (NIN) annotated in the poplar genome [21,2...

Ngày tải lên: 12/08/2014, 03:21

... questionnaire data and participated in the statistical analysis. CEP enrolled the patients, coordinated the data collection and acquired the medical data. FH helped to draft the manuscript and made substantial ... emotional function and mental health. The total score lies between 0 and 100, with higher values indicating a more favourable quality of life. Nor- mative data are...

Ngày tải lên: 13/08/2014, 03:20

... mechanisms. Proc Natl Acad Sci USA 103, 13813–13818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynojirimycin as a pharmacological chaperone ... concentration of partially active GC vari- ants, as demonstrated by increased cellular GC activity, an increased concentration of lysosomal GC glyco- forms and increased coloc...

Ngày tải lên: 18/02/2014, 16:20

... containing that residue. The average mass gain of N-terminal and C-terminal fragment ions are plotted as positive and negative, respectively, mass increases, with the molecular ion mass increases ... specific and potent HAD inhibitors. To check for covalent modifications of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an...

Ngày tải lên: 18/02/2014, 16:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3...

Ngày tải lên: 19/02/2014, 17:20