báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc

báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc

báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc

... Change in fibre SCW thickness, cell wall area, fibre cell area and lumen area of Eucalyptus sectors overexpressing Arabidopsis SND2. Sample Cell wall thickness (%) Cell wall area (%) Fibre ... ANAC019 (Arabidopsis NAC domain containing protein 19); transcription factor 1.44 3.07E-04 AT1G32770 ANAC012/NST3/SND1 (ARABIDOPSIS NAC DOMAIN CONTAINING...

Ngày tải lên: 11/08/2014, 11:21

51 445 0
báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps

báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps

... upstream of 2CPA translation start site was PCR amplified in five fragments using the primers AAACCATGGCATGCATAAGAGTC and TCCGGGAAATCCAGG for fragment 1, AAACCAT- GGCATGCATAAGAGTC and GATGACGGAGATGATG ... GATGACGGAGATGATG for fragment 2, TCTCCGTCATCGAAC and GCAGAGTTTCT- GGGT for fragment 3, AAACCATGGAATACCCAGAAACT and GCGTGACCGGAGACATG for fragment 4 and CTC- CGGTCACGCGATTCAAC an...

Ngày tải lên: 12/08/2014, 05:20

14 247 0
Báo cáo khoa học: Activation of activating transcription factor 2 by p38 MAP kinase during apoptosis induced by human amylin in cultured pancreatic b-cells ppt

Báo cáo khoa học: Activation of activating transcription factor 2 by p38 MAP kinase during apoptosis induced by human amylin in cultured pancreatic b-cells ppt

... Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; p38 kinase, p38 MAP kinase; p-ATF-2, phosphorylated activating transcription factor 2; rA, rat amylin; T2DM, type 2 diabetes mellitus. FEBS ... showed that hA elicited b -cell apoptosis via stimulated expression and activation of c-Jun accom- panied by increased activator protein-1 (AP-1) DNA binding and c-Jun transcripti...

Ngày tải lên: 07/03/2014, 12:20

13 400 0
báo cáo khoa học: " An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae" pptx

báo cáo khoa học: " An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae" pptx

... standard curve of a cDNA serial dilution of that gene. The expression was normalized to Fragaria × ana- nassa actin and Prunus cerasus actin with Fragaria vesca stage 1 flower bud and Prunus avium ... are listed in Additional File 4. Growth of Strawberry plants and Generation of 35S: FaMYB10 Fragaria × ananassa plants Strawberry plants of Fragaria × ananassa and Fragaria vesca wer...

Ngày tải lên: 12/08/2014, 03:21

17 333 0
báo cáo khoa học: " TaMSH7: A cereal mismatch repair gene that affects fertility in transgenic barley (Hordeum vulgare L.)" pot

báo cáo khoa học: " TaMSH7: A cereal mismatch repair gene that affects fertility in transgenic barley (Hordeum vulgare L.)" pot

... AACCACTCGAATAAGTTCTCAGTATCTATGAATGGTAAGCATATTGGAGCAGCTGCTACACTGTTTCCAGAAC N3BT3Ad (25) AACCACTCCAATAAGTTCTCAGTATCTATGAACAGTAAGAATATTGGAGCACCTGCTACACTGTTTCCGGAAC CS D (25) AACCACTCCAATAAGTTCTCAGTATCTATGAACAGTAAGAATATTGGAGCACCTGCTACACTGTTTCCGGAAC Tt ... AACCACTTGAATAAGTTCTCAGTATCTATGAATGGTAAGCATATTGGAGCACCTGCTACACTGTTTCCGGAAC CS A (25) AACCACTTGAATAAGTTCTCAGTATCTATGAATGGTAAGCATATTGGAGCACCT...

Ngày tải lên: 12/08/2014, 05:20

9 169 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... and run on 6% polyacrylamide sequencing gels: extension products were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA ... H3 has also been found in a diacetylated form in Drosophila and Tetrahymena, although this appears to be more transient, and the pattern of lysine residues acetylated in this mann...

Ngày tải lên: 19/02/2014, 12:20

10 501 0
Báo cáo khoa học: "Applying a Grammar-based Language Model to a Simplified Broadcast-News Transcription Task" ppt

Báo cáo khoa học: "Applying a Grammar-based Language Model to a Simplified Broadcast-News Transcription Task" ppt

... words in an utter- ance. More accurate statistical models of natural language have mainly been developed in the field of statistical parsing, e.g. Collins (2003), Charniak (2000) and Ratnaparkhi ... linguistically motivated grammar (a hand-crafted Head-driven Phrase Structure Grammar) and a statistical model estimating the probability of a parse tree. The language model is applie...

Ngày tải lên: 17/03/2014, 02:20

8 385 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

... GCTGTTATACCAGTATATGG EMSA, oligonucleotides for site 3 P3R CCATAT ACTGGTATAACAGC P4F TGGTGTACTAATTTGATCTATG EMSA, oligonucleotides for site 4 P4R CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA EMSA, oligonucleotides used ... footprinting P8 TGTTATACCAGTATATGGTGTACTA EMSA 94RTf CTCGGCCTCAACTACAGTCGT Reverse transcription 94RTr ACAGGTAGCTGAGCAGCAGAC Reverse transcription 1...

Ngày tải lên: 23/03/2014, 04:21

12 462 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

... F Garry* - rfgarry@tulane.edu * Corresponding author Abstract Background: A polymerase chain reaction (PCR)-based method for quantitating CD4 and CD8 mRNA could provide a means of assessing ... reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection Heather B Jaspan 1 , H Richard Gaumer 2 and Robert F Garry* 1,3 Address: 1 Interdisc...

Ngày tải lên: 11/08/2014, 08:20

4 319 0
w