báo cáo khoa học: "Loss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats" docx
báo cáo khoa học: "Loss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats" docx
... Y, Kakizaki Y, Yamamoto K, Shimada N, Yamamura S, Nishihara M: Identification and characterization of R2R3- MYB and bHLH transcription factors regulating anthocyanin biosynthesis in gentian flowers. ... 18(4):831-851. doi:10.1186/1471-2229-11-155 Cite this article as: Gillman et al.: Loss-of -function mutations affecting a specific Glycine max R2R3 MYB transcriptio...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... polyclonal ASA antiserum. Precipitated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm). Columns show mean, minimal and maximal deviation of arbitrary units of two independent ... were added to the cleared supernatants and incubation continued for 16 h at 4 °C. Five micrograms of an anti-mouse IgG, raised in rabbits, was added to the samples containing the mAbs...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx
... of administered inorganic mercury. Drug Metab Dispos 25, 516–523. 51 Shinozuka S, Tanase S & Morino Y (1982) Metabolic consequences of affinity labeling of cystathionase and alanine aminotransferase ... inhibitor) and propargyl- glycine (a cystathionine c-lyase inhibitor) were performed as described by Zalups and Lash [50] and Shinozuka et al. [51], respectively. Propargylglycin...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx
... cell lysates (Fig. 5A, lane 2). This smear was marginally revealed in the unstimulated cells (Fig. 5A, lane 1). These data strongly indicate that SDF-1 induces a rapid and significant increase in the ... hepari- tinase I and III mixture, we suggest the involvement of syndecan-4 and heparan sulfate in p44 ⁄ p42 mitogen-activated protein kinase and Jun N-ter- minal ⁄ stress-activ...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... It has been speculated that Aa-Pri1, and similar proteins, may have important roles in the initial phase of fungal fruiting, such as hyphae aggre- gation [4], or in apoptosis [1]. Their exact ... Z. Espinar, M.T. & Labare ` re, J. (1997) Cloning and sequencing of the Aa-Pri1 gene specifically expressed during fruiting initiation in the edible mushroom Agrocybe aegerita, and ana...
Ngày tải lên: 23/03/2014, 21:20
báo cáo khoa học: " How to develop a program to increase influenza vaccine uptake among workers in health care settings?" potx
... annual human influenza - Explain avian influenza on website All HCWs should get vaccinated HCWs understand the ethical aspects of influenza vaccination among HCWs - Explain and discuss ethical ... information meeting Conducting an information meeting Execute an information meeting with plenary information on influenza and influenza vaccination and discussion in smaller groups Informat...
Ngày tải lên: 10/08/2014, 10:23
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... 4-coumarate, caffeate, ferulate, sinapate and 3,4-dimethoxycinnamate, whereas it showed very low activity towards cinnamate. The recombinant 4CL2 was able to convert cinnamate, 4-coumarate, caffeate, and ... given in parentheses): Arabidopsis thaliana 4CL1 (U18675), A. thaliana 4CL2 (AF106086), A. thaliana 4CL3 (AF106088), G. max 4CL1 (AF279267), G. max 4CL2 (AF002259), G. max 4...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx
... generally found in the ovary and adrenal gland. In fishes, the adrenal homolog is not as compact as the adrenal gland found in mammals. In fishes, adrenal tissue exists as aminergic chromaffin and inter-regnal ... intracellular function(s). In vitro binding assays revealed a surprisingly low affinity of recombinant- derived human FABP6 and rat Fabp6 for long-chain fatty acids, s...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf
... 5¢-GATACGTCTCTC ACT CAAGGGATTGTAGCCTTCCGGCAGCATCTACAG AATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAG GAACCCCTTGGTCCTCGCGAGATTCTGTAGAT GCTGCCGGAAGGCTACAATCCCTTGAGTGAGA GACGTATC and 5¢-GATACGTCCCTTACACAAG GACTTAAGGCATTTAGACAACAGCTTCGGAAG AATGCTAGAACCAAAGGATTTCTG/5¢- ... and 5 ¢-CTTGCTAGAACCAAAGGATTTCT GGGGTTGAACAAAATAAAAGGGCTGGCTCGGC AAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTG ATCCCATTTGTCGAGC CAGCCCTTTTATTTTG...
Ngày tải lên: 30/03/2014, 15:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ⁄ W168F ⁄ Y74W TCA CCGGTCCATGATCCATT HaeIII Effect ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Mole...
Ngày tải lên: 18/02/2014, 11:20