báo cáo khoa học: "The ACR11 encodes a novel type of chloroplastic ACT domain repeat protein that is coordinately expressed with GLN2 in Arabidopsis" pptx

... the ACT domains of the ACR11 and ACR12 proteins may serve as amino acid binding domains. Upon binding to specific amino acids, the ACR11 and ACR12 proteins may regulate the activities of amino acid ... of four novel ACT domain- containing proteins, namely ACR9 to ACR12, in Arabidopsis. The ACR9 and ACR10 proteins contain three copies of the ACT domain, whereas the ACR...

Ngày tải lên: 11/08/2014, 11:21

... domain and two similar C-ter- minal domains with unknown structure and function. The N-terminal pro domain is autocatalytically cleaved off when the enzyme has obtained its active conforma- tion, ... and the two C-terminal domains are cleaved off by heat treatment at 50 °C. An Ala-Pro-Thr sequence is located in the first C-terminal domain. The tripeptide is not located in the...

Ngày tải lên: 19/02/2014, 07:20

... thaliana proteins also contain a PAC motif, and conversely that all PAC- annotated A. thaliana proteins contain a PAS domain. Therefore, in the case of A. thaliana,thePASandPAC motifs are inseparable, ... future. 3 Arabidopsis , Escherichia , Caenorhabditis and Azotobacter – a case study Some of the PAS domains have been analysed in detail. We chose four representative org...

Ngày tải lên: 19/02/2014, 12:20

... Location of the binding structures shows that the C-terminal domain of a- actinin and each calpain subunit, 28 and 80 kDa, participates in the interaction. In particular, the autolysed calpain form (76/18) ... the cleavage of asm by calpain 1 generates a fragment of 95 kDa which is unable to interact with Calp1. This indicates the presence of a calpain binding site...

Ngày tải lên: 07/03/2014, 21:20

... Indeed, the factors that main- tain the redox homeostasis of plasma thiols as well as the mechanisms that regulate the exchange of LMM- SH among cells need to be clarified. Here, we have analyzed the ... levels increased in plasma, indicating that Cys was released from an extra-hematic compartment. As in vivo studies based on treatments with diamide are essentially limited by i...

Ngày tải lên: 16/03/2014, 02:20

... show that the protection that a- crystallin provided against Na/K-ATPase inactivation was not due to the removal of fructose by binding to a- crystallin, BSA was resealed (in the same manner and ... test inactivation of the Na/K pump. Intracellular a- crystallin protected against the decrease in ouabain sensi- tive 86 Rb uptake, and therefore against inactivation induced by all...

Ngày tải lên: 17/03/2014, 03:20

... fused with a DNA fragment encoding the myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-Ala- Ala-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala was amplified by PCR with the primers AGG1 RV and 3A6 (A ... N-terminus to the myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala- Ala-Ala-Ala (Myr–AGG1-3X6S), with position 3 of ea...

Ngày tải lên: 29/03/2014, 21:20

... is essential to allow a precise localization of genes and markers, leading to completed genetic maps. For this purpose, a collection of large insert BAC (bacterial artificial ... authors, the actual standard karyotype description by GTG- and RBG-banding for the chicken, established by the International Committee for the Standardization of th...

Ngày tải lên: 09/08/2014, 18:21

... clients regarding the important domains for inclusion indicate that this is a reliable method f or assisting individuals with an acquired communication disability to participate in the identification of ... ajority of the domains which are viewed as important for inclu- sion at this stage of the rehabilitation process can be classified as activity domains (learning and thinkin...

Ngày tải lên: 12/08/2014, 00:20

... gene encoding GGPS was amplified using PCR with KOD DNA polymerase (Toyobo, Osaka, Japan) and the primers: PaG GPS-Fw, 5¢-AAGAAA CATATGACGGTCTGCGCAAA AAAACACG-3¢, and PaGGPS-Rv, 5¢-TGCAGA GGATCC TTAACTGACGGCAGCGAGTTTTTTG-3¢. ... interface. It is conceivable that a similar scenario also occurred in the I12 1A and V12 5A mutants of P. ananatis GGPS. The role of a- helix E in t...

Ngày tải lên: 07/03/2014, 06:20