Báo cáo y học: "Childhood autism in a 13 year old boy with oculocutaneous albinism: a case report" potx
... was once again in his own world. There was no abnormal motor activity. Physical examination and psychological investigation Physical examination revealed a young boy with features of oculocutaneous ... presentation: This article reports a case of co-morbid childhood autism and oculocutaneous albinism in a 13- year old boy from Nigeria in Sub-Saharan Africa. Conc...
Ngày tải lên: 11/08/2014, 11:20
... ATN Study design was consistent with American clinical practice, in that a continuum of care approach for AKI (that is, matching the appropriate therapy to the patient’s clinical status at different ... kidney survival by dialysis modality in critically ill patients with acute kidney injury. Int J Artif Organs 2007, 30:281-292. 18. Evanson JA, Himmelfarb J, Wingard R, Knights S, Shy...
Ngày tải lên: 13/08/2014, 11:22
... primer SIVmnd1C AGATTATAGACCCTATACTGC 5'second primer C-D* = 282 nt SIVmnd1D CATCCAATGAAAGGGAGGTTC 3' second primer SIVmnd 2A GGACATAGGGGATGCCTATT 5' first primer A- B = 356 nt SIVmnd2B CTGTCCATTTCTTTGGGTGC ... offspring (mandrills RAF, 3 years old and HAB, 2 months old) , showed that the female and one of the offspring (HAB) were also SIV antibody-positive. Both EDTA-plas...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx
... other healthcare professional s and promoting interdisciplinary care including becoming more involved with primary healthcare teams within the NHS. List of abbreviations AAFP: The American Academy ... LA, Fryer GE: Chiropractors are not a usual source of primary health care. Am Fam Physician 2004, 69(11):2544. 15. American Academy of Family Physicians: Policy & Advocacy: Primary Care....
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Early reduction in painful physical symptoms is associated with improvements in long-term depression outcomes in patients treated with duloxetine" pdf
... self-rated VAS for overall pain, headache, shoulder/neck pain, back pain, joint pain, thoracic pain, and abdominal pain. Changes in painful and non-painful physical symp- toms were assessed by the ... reporting a very low Table 3 Statistically Significant Variables at Baseline and after 4 Weeks in the Regression Analysis of the Mean KUSTA Score at 6 Months a) All patients (N = 2574) Va...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Undifferentiated giant cell type carcinoma of the gallbladder with sarcomatoid dedifferentiation: a case report and review of the literature" ppsx
... presentation and the imaging and intra-operative findings of gallbladder empyema in our patient. Incidental finding of gallbladder carcinoma follow- ing cholecystectomy for symptomatic cholelithiasis, acute cholecystitis, ... giant cell carcinoma with osteoclast-like giant cells. Am J Surg Pathol 2006, 30(4):495-500. 6. Akatsu T, Kameyama K, Kawachi S, Tanabe M, Aiura K, Wakabayashi G, Ue...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: "Recurrent late complications following congenital diaphragmatic hernia repair with prosthetic patches: a case series" doc
... the manuscript. References 1. Moyer V, Moya F, Tibboel R, Losty P, Nagaya M, Lally KP: Late versus early correction for congenital diaphragmatic hernia in newborn infants. Cochrane Database Syst ... 38(3):296-300. 10. Okazaki T, Hasegawa S, Urushihara N, Fukumoto K, Ogura K, Minato S, Kawashima S, Kohono S: Toldt’s fascia flap: a new technique for repairing large diaphragmatic hernias. Pe...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " An RNAi in silico approach to find an optimal shRNA cocktail against HIV-1" potx
... CCAGTAAAATTAAAaCCAGGAATG 2 9, 10 60 (9) 74 (10) 208 h CCAGTAAAATTAAAGCCAGGAATG 3 9, 10 926 (9) 1267 (10) 3448 CCAGTAAAATTgAAGCCAGGAATG 2 9, 10 48 (9) 77 (10) 202 r 2702-2725 GCCTGAAAATCCcTACAATACTCC ... 229 GCCTGAAAAcCCATACAATACTCC 5 2,9 4 (2) 62 (9) 66 n 2333-2356 AGCAGATGATACAGTAgTAGAAGA 6 1,2,3,4,5,6 10 (1) 18 (6) 85 AGCAGATGATACAGTgTTAGAAGA 6 1,2,3,4,5,6 23 (1) 33 (4,6) 174 AGCAGATGATACAG...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: " Pericardial effusion as the only manifestation of infection with Francisella tularensis: a case report" pps
... analysis of bacterial tests and in writing a first draft, PYL participated in collecting the data and in following the patient's case, and contributed to the discussion, GH participated in ... discussion. All authors read and approved the final manuscript. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: " HIV research in Australia: linking basic research findings with clinical and public health outcomes" ppsx
... fellows and graduate students interested in HIV and AIDS to attend IAS 2007 and enjoy the science, Syd- ney and Australia. Competing interests Financial: nil Non-financial: DAC is Local Chair and ... Corresponding author Abstract Despite a population of only 20 million and sustained low prevalence of HIV infection in Australia, Australian researchers have provided many substantial orig...
Ngày tải lên: 13/08/2014, 09:20