Báo cáo y học: "Childhood autism in a 13 year old boy with oculocutaneous albinism: a case report" potx
Báo cáo y học: "Childhood autism in a 13 year old boy with oculocutaneous albinism: a case report" potx
... was once again in his own world. There was
no abnormal motor activity.
Physical examination and psychological investigation
Physical examination revealed a young boy with features
of oculocutaneous ... presentation: This article reports a case of co-morbid childhood autism and
oculocutaneous albinism in a 13- year old boy from Nigeria in Sub-Saharan Africa.
Conc...
Báo cáo y học: "Dialysis dose in acute kidney injury: no time for therapeutic nihilism – a critical appraisal of the Acute Renal Failure Trial Network study" ppt
... ATN
Study design was consistent with American clinical practice,
in that a continuum of care approach for AKI (that is,
matching the appropriate therapy to the patient’s clinical
status at different ... kidney survival by dialysis
modality in critically ill patients with acute kidney injury. Int J
Artif Organs 2007, 30:281-292.
18. Evanson JA, Himmelfarb J, Wingard R, Knights S, Shy...
Báo cáo y học: " SIVdrl detection in captive mandrills: are mandrills infected with a third strain of simian immunodeficiency virus?" potx
... primer
SIVmnd1C AGATTATAGACCCTATACTGC 5'second primer C-D* = 282 nt
SIVmnd1D CATCCAATGAAAGGGAGGTTC 3' second primer
SIVmnd 2A GGACATAGGGGATGCCTATT 5' first primer A- B = 356 nt
SIVmnd2B CTGTCCATTTCTTTGGGTGC ... offspring (mandrills RAF, 3 years old and
HAB, 2 months old) , showed that the female and one of
the offspring (HAB) were also SIV antibody-positive.
Both EDTA-plas...
Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx
... other
healthcare professional s and promoting interdisciplinary
care including becoming more involved with primary
healthcare teams within the NHS.
List of abbreviations
AAFP: The American Academy ... LA, Fryer GE: Chiropractors are not a usual
source of primary health care. Am Fam Physician 2004, 69(11):2544.
15. American Academy of Family Physicians: Policy & Advocacy: Primary Care....
Báo cáo y học: "Early reduction in painful physical symptoms is associated with improvements in long-term depression outcomes in patients treated with duloxetine" pdf
... self-rated VAS
for overall pain, headache, shoulder/neck pain, back
pain, joint pain, thoracic pain, and abdominal pain.
Changes in painful and non-painful physical symp-
toms were assessed by the ... reporting a very low
Table 3 Statistically Significant Variables at Baseline and after 4 Weeks in the Regression Analysis of the Mean KUSTA
Score at 6 Months
a) All patients (N = 2574)
Va...
Báo cáo y học: "Undifferentiated giant cell type carcinoma of the gallbladder with sarcomatoid dedifferentiation: a case report and review of the literature" ppsx
... presentation and the imaging and
intra-operative findings of gallbladder empyema in our
patient. Incidental finding of gallbladder carcinoma follow-
ing cholecystectomy for symptomatic cholelithiasis, acute
cholecystitis, ... giant cell carcinoma with osteoclast-like giant
cells. Am J Surg Pathol 2006, 30(4):495-500.
6. Akatsu T, Kameyama K, Kawachi S, Tanabe M, Aiura K, Wakabayashi
G, Ue...
Báo cáo y học: "Recurrent late complications following congenital diaphragmatic hernia repair with prosthetic patches: a case series" doc
... the
manuscript.
References
1. Moyer V, Moya F, Tibboel R, Losty P, Nagaya M, Lally KP: Late
versus early correction for congenital diaphragmatic hernia
in newborn infants. Cochrane Database Syst ... 38(3):296-300.
10. Okazaki T, Hasegawa S, Urushihara N, Fukumoto K, Ogura K,
Minato S, Kawashima S, Kohono S: Toldt’s fascia flap: a new
technique for repairing large diaphragmatic hernias. Pe...
Báo cáo y học: " An RNAi in silico approach to find an optimal shRNA cocktail against HIV-1" potx
... CCAGTAAAATTAAAaCCAGGAATG 2 9, 10 60 (9) 74 (10) 208
h
CCAGTAAAATTAAAGCCAGGAATG 3 9, 10 926 (9) 1267 (10) 3448
CCAGTAAAATTgAAGCCAGGAATG 2 9, 10 48 (9) 77 (10) 202
r
2702-2725 GCCTGAAAATCCcTACAATACTCC ... 229
GCCTGAAAAcCCATACAATACTCC 5 2,9 4 (2) 62 (9) 66
n
2333-2356 AGCAGATGATACAGTAgTAGAAGA 6 1,2,3,4,5,6 10 (1) 18 (6) 85
AGCAGATGATACAGTgTTAGAAGA 6 1,2,3,4,5,6 23 (1) 33 (4,6) 174
AGCAGATGATACAG...
Báo cáo y học: " Pericardial effusion as the only manifestation of infection with Francisella tularensis: a case report" pps
... analysis of bacterial tests and in
writing a first draft, PYL participated in collecting the data
and in following the patient's case, and contributed to the
discussion, GH participated in ... discussion. All
authors read and approved the final manuscript.
Consent
Written informed consent was obtained from the patient
for publication of this case report and any accompanying...
Báo cáo y học: " HIV research in Australia: linking basic research findings with clinical and public health outcomes" ppsx
... fellows and graduate students interested in HIV
and AIDS to attend IAS 2007 and enjoy the science, Syd-
ney and Australia.
Competing interests
Financial: nil
Non-financial: DAC is Local Chair and ... Corresponding author
Abstract
Despite a population of only 20 million and sustained low prevalence of HIV infection in Australia,
Australian researchers have provided many substantial orig...
Từ khóa: