Báo cáo y học: " Vaccine based on a ubiquitous cysteinyl protease and streptococcal pyrogenic exotoxin A protects against Streptococcus pyogenes sepsis and toxic shock" pptx

... Publisher. All rights reserved Research Paper Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population Wellman W Cheung 1  , William Blank 1 , ... prevalence of OAB in urologic male veterans popula- tion, the need for OAB screening, and risk factors for OAB. METHODS An IRB-approved self-adm...

Ngày tải lên: 25/10/2012, 11:35

... FEBS 2002 NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 Heiko Moăller 1 , ... enhances binding affinity of glycopeptides to the antibody [18]. Conventional pepscan analysis however, does not allow easy analysis...

Ngày tải lên: 21/02/2014, 15:20

... syndrome and alter the course of established disease. These data suggest that autologous T cells primed and expanded with TGF-β have the potential to be used as a therapy for patients with systemic ... systemic lupus erythematosus and other chronic inflammatory diseases. This novel adoptive immunotherapy also has the potential to prevent the rejection of alloge...

Ngày tải lên: 09/08/2014, 03:24

... RESEARC H ARTIC LE Open Access Postresectional lung injury in thoracic surgery pre and intraoperative risk factors: a retrospective clinical study of a hundred forty-three cases Serdar Şen 1* , ... deaths [2]. ARDS formally defined as a syndrome of inflammation and increased permeability, is associated with a constella- tion of clinical, radiol...

Ngày tải lên: 10/08/2014, 09:22

... 4 Canadian Health Services Research Foundation, Ottawa, Canada, 5 Department of Health Policy, Management and Evaluation Faculty of Medicine, University of Toronto, Toronto, Canada and 6 Canadian ... Review Use of communities of practice in business and health care sectors: A systematic review LindaCLi* 1 , Jeremy M Grimshaw 2 , Camilla Nielsen 3 , M...

Ngày tải lên: 11/08/2014, 05:21

... Therapies and Vaccines Open Access Original research Vaccine based on a ubiquitous cysteinyl protease and streptococcal pyrogenic exotoxin A protects against Streptococcus pyogenes sepsis and toxic ... 3' 2. SpeA reverse primer, with SpeB overlap: 5' GAGATTTAACAACTGGTTGCTTGGTTGTTAGGTAGAC 3' 3. SpeB forward primer, with SpeA overlap: 5&apo...

Ngày tải lên: 11/08/2014, 10:23

... using content analysis. Data analysis A distinctive feature of a comparative multiple case study is the analysis of data on three different levels: Firstly at individual case level, secondly at group ... satisfaction with care by both patients and informal c aregivers. Finally, we aim for a positive effect on attitudes, knowl- edge and skills of nurses. Collab...

Ngày tải lên: 11/08/2014, 15:22

... lesion was initially regarded as a squamous cell carcinoma. The lesion's clinical presentation, its location, the otherwise normal skin, and the lack of any predisposing factors with the exception ... 1 A primary Kaposi's sarcoma on a hand, which was first regarded as a squamous cell carcinoma. A wide and deep total excision of the lesion was...

Ngày tải lên: 11/08/2014, 21:22

... Central Page 1 of 5 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Double primary bronchogenic carcinoma of the lung and papillary thyroid carcinoma: ... confirmed the diagnosis of a double primary pulmonary adenocarci- noma and thyroid papillary carcinoma (see figure 3). Discussion Patients with...

Ngày tải lên: 11/08/2014, 21:22

... Medical Case Reports Open Access Case report Spontaneous rupture of an infected renal cyst and external drainage through a lumbar surgical scar in a male patient with cervical spinal cord injury: ... injury patients with no urinary symptoms and spinal cord injury patients with symptoms related to urinary tract: do findings of ultra...

Ngày tải lên: 11/08/2014, 23:21

... observation of the suppression of HAV IRES- mediated transl ation by amantadine and IFN-alpha. Sup- pression effects at 48 h after transfection by the combina- tion of amantadine and IFN-alpha against ... were evaluated with ELISA. Sup- pression of HAV replication by the combination of amantadine and IFN-alpha was stronger than those of amantadine alo...

Ngày tải lên: 12/08/2014, 01:21

... bridging enzyme linked immunosorbent assay (ELISA) was used to measure anti -allotype antibodies against adalimumab. The association between AAA and the G1m3 and the G1m17 allotypes was determined. ... data analysis and EG and MH in carrying out the immunoassays. GB, LA and GW participated in the interpretation of the data. All authors participated in the preparation of the man...

Ngày tải lên: 12/08/2014, 15:22

... RESEARC H Open Access Polymorphisms of two histamine-metabolizing enzymes genes and childhood allergic asthma: a case control study Aleksandra Szczepankiewicz 1* , Anna Bręborowicz 2 , Paulina ... two histamine-metabolizing enzymes genes and childhood allergic asthma: a case control study. Clinical and Molecular Allergy 2010 8:14. Submit your ne...

Ngày tải lên: 13/08/2014, 13:22

... credibility of information on the sites, and a minor- ity of sites containing evidence-based information related to back pain [8]. Mathur and associates investiga ted the quality of information related ... respon- sibility for the content of information on their sites. In a review of readability of sites related to spine -related edu- cational...

Ngày tải lên: 13/08/2014, 15:21

Ngày tải lên: 13/08/2014, 18:21