Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

... immunoassays, data acquisi- tion and analysis. MM carried out blood cells isolation and stimulation. GP was involved in the coordination of the study and in the drafting of the manuscript. FT ... that are potent inducers of inflammation ("danger signals"). In addition to the TLR agonists that are innate immunity ligands, the immune response involves two adaptive immunity ligan...

Ngày tải lên: 11/08/2014, 10:23

15 330 0
Báo cáo y học: " TopHat-Fusion: an algorithm for discovery of novel fusion transcript" doc

Báo cáo y học: " TopHat-Fusion: an algorithm for discovery of novel fusion transcript" doc

... CCAGATGAAAACTCGCTGGATTTTTCCTCCTGTATGTTACGGCCG CCTCACAGCCAGATGAAAACTCGCTGGATTTTTCCTCCTGTATGTTACGG CCCAGATGAAAACTCGCTGGATTTTTCCTCCTGTATGTTACGGCCTGGGA ATGAAAACTCGCTGGATTTTTCCTCCTGTATGTTACGGCCTGGGATTAAA AAAACTCGCTGGATTTTTCCTCCTGTATGTTACGGCCTGGGATTAAAAAT ACTCGCTGGATTTTTCCTCCTGTATGTTACGGCCTGGGATTAAAAATGCT CGCTGGATTTTTCCTCCCGTATGTTACGGCCTGGGATTAAAAATGCTCAG TGGATTTTTCCTCCTGTATGTTACGGCCTGGGATTAAAAATGC...

Ngày tải lên: 09/08/2014, 23:20

15 381 0
Báo cáo y học: "Acetaminophen poisoning: an update for the intensivist" potx

Báo cáo y học: "Acetaminophen poisoning: an update for the intensivist" potx

... [12]. Liver transplantation and acetaminophen poisoning There are no standard selection criteria for transplantation that are in use worldwide, but the King’s College Hospital criteria (Table 2) are the ... than vomiting. Gyamlani and Parikh [7] recommended that patients with deliberate acetaminophen poisoning be managed on medical floors, but that patients with accidental ingestion and c...

Ngày tải lên: 12/08/2014, 18:21

4 346 0
Báo cáo y học: "The Inferelator: an algorithm for learning parsimonious regulatory networks from systems-biology data sets de novo" pptx

Báo cáo y học: "The Inferelator: an algorithm for learning parsimonious regulatory networks from systems-biology data sets de novo" pptx

... page) cspd1 tfbf VNG0424C VNG0703H 191 1 nirh AND nusa 98 AND illumination boa2 gamma 319 AND 388 AND cspd2 3 7 12 16 VNG0194H 25 49 50 55 71 79 tfbg 113 123 2 VNG0040C tbpe 19 24 29 67 VNG0066H 128 VNG5075C 263 VNG0039H AND rhl VNG0320H tfbb VNG1029C 59 170 283 kaic AND trh7 156 tbpd 89 219 416 423 432 449 4 5 8 gvpe2 28 oxygen 141 148 182 188 200 338 AND tbpc 210 6 phou prp1 arsr sirr 76 12...

Ngày tải lên: 14/08/2014, 16:21

16 305 0
Báo cáo y học: "Patterns of Expression of Vaginal T-Cell Activation Markers during Estrogen-Maintained Vaginal Candidiasis" doc

Báo cáo y học: "Patterns of Expression of Vaginal T-Cell Activation Markers during Estrogen-Maintained Vaginal Candidiasis" doc

... Hamad M, Muta’eb E, Abu Shaqra Q, et al. Utility of the estrogen- dependent vaginal candidiasis murine model in evaluating the e- cacy of various therapies against vaginal C. albicans infection. ... and from estrogen- treated Candida albicans–infected experimental mice at day  postinfection were sepa- rately pooled from ve to six mice and stained with anti- CD and anti- CD for...

Ngày tải lên: 08/08/2014, 21:20

7 346 0
Báo cáo y học: "Effects of etizolam and ethyl loflazepate on the P300 event-related potential in healthy subjects" docx

Báo cáo y học: "Effects of etizolam and ethyl loflazepate on the P300 event-related potential in healthy subjects" docx

... Nozaki S, Inagaki A, Furukawa TA: Efficacy of diazepam as an anti- anxiety agent: meta-analysis of double -blind, randomized controlled trials carried out in Japan. Human Psychopharmac Clin Exp ... ANOVA indicated significant practice effects of repeated testing, but not effects of drug group, on test scoring without a signifi- cant interaction, in some tests including trail making...

Ngày tải lên: 09/08/2014, 01:21

7 829 0
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

... participated in patient recruitment, statistical analysis, and manuscript preparation. HH participated in the coordination of the study and helped with patient recruitment and manuscript preparation. ... factor for inflammation. Introduction Rheumatoid arthritis (RA) is a chronic inflammatory disease characterised by intense immune activation within the synovial compartment of joints...

Ngày tải lên: 09/08/2014, 08:22

11 363 0
Báo cáo y học: "Dietary fatty acid intake affects the risk of developing bone marrow lesions in healthy middle-aged adults without clinical knee osteoarthritis: a prospective cohort study" docx

Báo cáo y học: "Dietary fatty acid intake affects the risk of developing bone marrow lesions in healthy middle-aged adults without clinical knee osteoarthritis: a prospective cohort study" docx

... development of OA, this study suggests that dietary modification of fatty acid intake may be one strategy in the prevention of knee OA which warrants further investigation. Introduction Nutritional factors ... no significant association between fatty acid consumption and the incidence of BMLs over 2 years in univariate analysis, higher consumption of saturated fatty acids was significantl...

Ngày tải lên: 09/08/2014, 14:20

5 386 0
Báo cáo y học: "Predicting outcome of rethoracotomy for suspected pericardial tamponade following cardio-thoracic surgery in the intensive care unit" ppt

Báo cáo y học: "Predicting outcome of rethoracotomy for suspected pericardial tamponade following cardio-thoracic surgery in the intensive care unit" ppt

... prior to rethoracotomy, because of hemodynamical instability and high clinical suspicion of tamponade these patients went straight to the operating room. In the remaining 19 patients echocardiography ... even echocardiographic variables obtained in the ICU. Our data suggest that in patients with severe haemodynamic compromise in the ICU after primary cardio-thoracic surgery, without h...

Ngày tải lên: 10/08/2014, 09:21

7 364 0
Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx

Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx

... Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature Valentina Tabanelli 1 , Claudio Agostinelli 1 , Elena Sabattini 1 , Anna ... research, analyzed data and wrote the manuscript; CA performed research and analyzed data; ES and FB analyzed data; SC and GM were responsible for patient car...

Ngày tải lên: 10/08/2014, 23:21

5 379 0
w