Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot
... substantial apoptotic tumor cells for DC loading. Because both activated mono- cytes and apoptotic malignant T cells are obtained indi- vidually and can be re-added after treatment, the optimal conditions ... essentially as described by the manufacturer. Statistical evaluation The expression of DC markers and the MLC response was evaluated statistically by the student's...
Ngày tải lên: 11/08/2014, 10:23
... complete encapsulated tumors do not require any Table 4: Univariate and multivariate analysis of cancer-related survival in the total population a Risk factor Univariate analysis Multivariate analysis c p ... chemotherapy and/ or radiation therapy, 33 patients were taken into an adjuvant therapy regime. In detail, 3 patients were either treated alone with neoadju- vant chemotherapy or...
Ngày tải lên: 10/08/2014, 10:20
... not infect intact cells and are transmitted vertically by intracellular routes (meiosis and mitosis) and horizontally by anastomosis of compatible hyphae or through sexual mating of yea st cells. ... small amounts of yeasts or micelia a s initial material to obtain a sufficient quantity of dsRNA that can later be analyzed by electrophoresis in agaro se gel, quantified by d...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx
... Reactivity was demonstrated using an Ouchterlony gel diffusion assay and demonstrated reactivity at 1 mg/ml against rabbit anti-goat IgG (data not shown). Purity and extent of digestion was determined ... fatality rate. When left untreated gastrointestinal infections can progress rapidly and have over 80% case fatality rates. Inhalation anthrax infections are rare but have a high ca...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc
... and ELISA, real-time PCR offers an eff ective way to detect target fragments specifically, rapidly and quantitatively. False- positive re sults and pollution can be prevented eff ec- tively at ... and a TaqMan probe for PCV2. We have estab- lished an assay that is specific and sensitive for detection and quantitation of PCV2. Materials and methods Design of primers and T...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... GGCTTCTCCGGGTTTTTCTTCCTA 24 371f CCCGGGTTGAAAAGCCTCGTGT 22 371 b 371r TGTAACTTATCCTCCCTGAATCTG 24 a Length of product amplified by one step real-time RT-PCR primer pair. b Length of product amplified by conventional ... region of PRRSV N gene. Results: The sensitivity of the real-time qRT-PCR assay was achieved through PRRSV ch- 1a RNA for the generation of a standard curve...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Rapid development of intestinal cell damage following severe trauma: a prospective observational cohort study" doc
... using a Kryptor-Assay (Brahms, Henningsdorf, Germany). Statistical analysis First, the plasma i-FABP levels of all trauma patients on admit- tance and at days 1 and 2 were compared with healthy control values. ... presentation at the ER. • The presence of shock and the severity of local and overall injury are related to the extent of early intestinal cell damage. • Early...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the ... amount of antibiotic consumption as total weight (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer data- bases, and 2) Internatio...
Ngày tải lên: 25/10/2012, 11:00
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... ataP10 and ataP7. The two additional ones were named ata12 and ataPKS1 (Figs 2 and 3). All shared a codon usage and a G+C content at the third position typical of Streptomyces [28]. Other characteristics of ... complementa- tion assays. The ataP5, ataP4 and ataP10 genes were also independently inserted in the pIJ702 vector and the resulting plasmids pA 2A5 , pA 2A4 and p...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... polyacrylamide gels, blotting t o nitrocellulose and probing with antip26 antibody before scanning. Each densitometer value (arbitrary units) was plotted against the amount of cell free extract ... linear portion of a standard curve established for quantitation o f p26. The standard curve was prepared by electrophoresing different amounts of cell free extract from Artemia cyst...
Ngày tải lên: 22/02/2014, 04:20