... effect. In addition, the induction of injury was performed in anaesthetised healthy pigs. Thus, the physiological response to such things as pain and inflam- mation may have additional effects on haemostasis, which ... polyclonal rab- bit, DAKO, Glostrup, Denmark) and polyclonal rabbit von Willebrand factor VIII antibody (DAKO, A0 082, polyclonal rabbit) were used at a concentr...
Ngày tải lên: 13/08/2014, 20:21
Báo cáo y học: "Effects of monoclonal anti-PcrV antibody on Pseudomonas aeruginosa-induced acute lung injury in a rat model" ppt
... Immune Based Therapies and Vaccines Open Access Original research Effects of monoclonal anti-PcrV antibody on Pseudomonas aeruginosa-induced acute lung injury in a rat model Karine Faure 1,4 , ... by Pseudomonas aeruginosa were analyzed in a rat model. Methods: Lung injury was induced by the instillation of P. aeruginosa strain PA103 directly into the...
Ngày tải lên: 11/08/2014, 10:23
... ity Recommendations of accu- mulating at least 30 minutes, above one’s usual activity, of moderate-intensity physical activity five to seven days a week by integrating short bouts of activity into ... often substantially hampers day-to-day functioning and is a primary cause of disability [5]. Even with the recent Food and Drug Administration approval of medications to treat FM,...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: " Effects of CYP2B6 G516T polymorphisms on plasma efavirenz and nevirapine levels when co-administered with rifampicin in HIV/TB co-infected Thai adults" ppt
... Kumar AK, Jagan I, Vasantha M, Padmapriyadarsini C, Narendran G, Rajasekaran S, Swaminathan S: Association of high T allele frequency of CYP2B6 G516T polymorphism among ethnic south Indian HIV-infected ... 2010 References 1. Cain KP, Anekthananon T, Burapat C, Akksilp S, Mankhatitham W, Srinak C, Nateniyom S, Sattayawuthipong W, Tasaneeyapan T, Varma JK: Causes of death in HIV-infecte...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Effects of evening light conditions on salivary melatonin of Japanese junior high school students" ppsx
... rhythm and sleep-wake cycle. Effects of light condition on salivary melatonin concentrationFigure 1 Effects of light condition on salivary melatonin concentration. Values shown are means (n = ... morning and then decreases again rap- idly to the extremely low concentration typical of the daytime [7,8]. The increase in melatonin concentration might occur in late evening and trigg...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf
... 8:25 http://www.journal-inflammation.com/content/8/1/25 Page 7 of 7 RESEARCH Open Access Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts Linn a Asp 1 , ... this article as: Asp et al.: Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts. Journal of Infla...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot
... Sense CACATCTGGCAGCCAACAAG Anti-sense CACTGGCAACATTAATAATGTTGCA KAT3 CCBL2 Sense ACTATCAGCCATCCCCGTTTC Anti-sense AATGAAGCAAAAACGCACAAACT KAT4 GOT2 Sense TGTGGTGTGCAGCCTCTCAT Anti-sense AAGCCTGAACCCAGCTAGCA KYNU ... CTAGTAGATGCCCACTGAATATTTGTG HAAO HAAO Sense GGACGTTCTGTTTGAGAAGTGGTT Anti-sense AGCTGAAGAACTCCTGGATGATG KAT1 CCBL1 Sense CCTGCTAAGGCTCAGGTATAACCT Anti-sense GGACTCAAGCCTAAAGGCAACT...
Ngày tải lên: 11/08/2014, 06:23
Báo cáo y học: " Effects of supplemental fish oil on resting metabolic rate, body composition, and salivary cortisol in healthy adults" ppsx
... Kobayashi H, Ashakumary L, Rouyer IA, Takahashi Y, Aoyama T, Hashimoto T, Mizugaki M: Comparative effects of perilla and fish oils on the activity and gene expression of fatty acid oxidation ... collection, statistical analysis and manuscript preparation. MJS, MLC, VAP and LKA contributed in the design of the study, data collection, and manuscript preparation. JB contributed with d...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: " Effects of cigarette smoke condensate on proliferation and wound closure of bronchial epithelial cells in vitro: role of glutathione" pdf
... persistent activation of ERK1/ 2, a MAPK involved in cell proliferation. Inhibition of cell proliferation by high concentrations of CSC was associated with activation of the pro-apoptotic MAP kinases ... present study. In addition to the MAPK pathway, the Akt/PI-3 kinase pathway may play an important role in CSC- induced epithelial cell proliferation. Finally, a stimulatory...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Effects of redox cycling compounds on DT diaphorase activity in the liver of rainbow trout (Oncorhynchus mykiss)" doc
... M -1 cm -1 ). Protein content was determined using the BCA Protein Assay Kit (Pierce, USA), with BSA as standard. Statistical analysis Data were analyzed with one-way analysis of variance (ANOVA) and, following ... preventing redox cycling and consequently quinone dependent production of reactive oxygen species. In rat and mouse, a wide range of chemicals including polyaromatic hy...
Ngày tải lên: 13/08/2014, 13:20