Báo cáo khoa hoc:" Reversal of isolated unilateral optic nerve edema with concomitant visual impairment following blunt trauma: a case report" potx
... but may result in permanent visual disability. Isolated trauma of the optic nerve is usually associated with blunt skull trauma involving fractures of both skull and optic canal, but may also ... post-traumatic optic neuropathy after maxillofacial blunt trauma. In their review the number of blind eyes was 14 and all patients suffered from midfacial fractures. Isolated...
Ngày tải lên: 11/08/2014, 10:23
... this case. Conclusion We report a rare case of low-grade B-cell lymphoma with abundant intracellular Ig accumulation. The patient’s clinical presentation and MRI suggested a soft- tissue tumor, and ... diseases [1,7]. Finally, a special low-grade lymphoplasmacytic lym- phoma with abundant intracytoplasmic Ig inclusions was demonstrated on the basis of immunohistochemical, ul...
Ngày tải lên: 11/08/2014, 00:22
... hospital due to jaundice. On the basis of cholestatic laboratory findings with elevated lipase and concomitant abdominal pain, an endoscopic retrograde cholangiopancreatogra- phy (ERCP) was performed. ... presented with jaundice, elevated ALT, AST, lipase and concomitant abdominal pain. He was found to be positive for HCV-RNA (genotype 3a) and was diagnosed with acute hepatitis C....
Ngày tải lên: 11/08/2014, 10:22
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc
... parameter A of actin was close to 2.4. Increase of the time of heating at 43 °C leading to decrease of parameter A up to 2.2–2.3 was accompanied by further decrease of the initial rate of polymerization. ... 2% of inactivated actin, whereas parameter A for inactivated and completely unfolded actin is equal to 1.3 and 0.4, respect- ively [5]. The interaction of intact and...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt
... by the use of the formal device of functional un- certainty, as defined by Kaplan and Zaenan [3] and Kaplan and Maxwell [2]. In this paper, we relate this characterization to that provided ... K. Vijayashanker. A Study of Tee Adjoining Grammars. PhD thesis, University of Penn- sylvania, Philadelphia, Pa, 1987. K. Vijay-Shanker and A. K. Joshi. Fea- ture structure based t...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx
... GGA TCC GAT GAC CA- C AGA AGA TCA TTC TT-3¢) and TnrA6 (5¢-TTA ACG GGA TCC GTA CCG TTA GTG AGC ATT AAG- 3¢). The PCR products were purified, digested with BamHI, and ligated into the BamHI-digested ... to TnrA. Fig. 2. BIAcore analysis of GlnK–TnrA complex formation and ATP effect on dissociation of the GlnK–TnrA complex. The analyte GlnK was injected in a volume of 30 lL at a flow...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Interaction of Sesbania mosaic virus movement protein with the coat protein – implications for viral spread Soumya Roy Chowdhury and Handanahal Subbarao Savithri docx
... 19 anti CCGA AAGCTT GAATTCCGGACACGAATAGAAGTATTC Primer for amplification of the MP CD19 gene. The HindIII site is indicated in bold and the EcoRI site is underlined E.MP C38 anti CCGA AAGCTT GAATTCCGGCCCGTTTTCACAAGGAGC ... would A B Fig. 9. Quantification of the MP–CP Y2H interaction by b-galactosi- dase assay and estimation of the level of protein expression. (A) A b-galactosidase...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Characterization of rat cathepsin E and mutants with changed active-site residues and lacking propeptides and N-glycosylation, expressed in human embryonic kidney 293T cells ppt
... Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hamster ovary cells. ... observed mainly as a 46-kDa precursor with a small amount of the 42-kDa mature form. A small amount of the pro- enzyme was released into the culture medium as a 48-kDa form and a...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Kinetics of intra- and intermolecular zymogen activation with formation of an enzyme–zymogen complex ppt
... 11308–11314. 16 Magklara A, Mellati AA, Wasney GA, Little SP, Sotiropoulou G, Becker GW & Diamandis EP (2003) Characterization of the enzymatic activity of human kallikrein 6: Autoactivation, substrate ... has been analysed in both analytical and numerical ways, thus showing the goodness of the analysis. The above suggested mathematical analysis has been applied to the pepsinogen–p...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt
... S., Sawa, H., Komagome, R., Orba, Y., Yamada, M., Okada, Y., Ishida, Y., Nishihara, H., Tanaka, S. & Nagashima, K. (2001) Broad distribution of the JC virus receptor contrasts with a marked ... control reaction with DNA polymerase a- primase lacking TAg or vice versa; lanes 3 and 4, 0.2 U and 0.4 U of human; lanes 5 and 6, 0.2 U and 0.4 U of murine DNA polymerase a- primase....
Ngày tải lên: 17/03/2014, 03:20