Báo cáo khoa hoc:" Endovascular stenting of a chronic ruptured type B thoracic aortic dissection, a second chance: a case report" potx
... STR: Endovascular < /b> repair of < /b> a < /b> ruptured < /b> chronic < /b> type < /b> B aortic dissection. J Vasc Surg 2002, 36:401-3. 6. Toyama M, Usui A,< /b> Yoshikawa M, Ueda Y: Thoracic aneurysm rupture due to graft perforation after ... corrected calcium of < /b> 2.77 mmol/l. SCTA revealed a < /b> haematoma in the left mid -thoracic cavity asso- ciated with vertebral...
Ngày tải lên: 11/08/2014, 10:23
... instead of < /b> using only for rare words as is described in Ratnaparkhi (1996). This can be explained by the fact that due to small amount of < /b> annotated data, a < /b> significant number of < /b> instances ... have been developed for English, German and other European Lan- guages, for which large labeled data is available. Our aim here is to develop a < /b> stochastic POS tag-...
Ngày tải lên: 31/03/2014, 01:20
... have vessels of < /b> smaller cross-sectional areas than late flushing ones. In oak, new vessels are formed about 1 week after buds break. In- dole-3-acetic acid (IAA) is believed ... individual j of < /b> genotype or family i, μ is the overall Original article Genetic determination of < /b> vessel area in oak (Quercus robur L and Q petra...
Ngày tải lên: 08/08/2014, 19:21
báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps
... Jette AM: Functional Status Index: reliability of < /b> a < /b> chronic < /b> disease evaluation instrument. Arch Phys Med Rehabil 1980, 61(9):395-401. 76. Lorish CD, Abraham N, Austin JS, Bradley LA, Alarcon GS: A < /b> ... traditional physical, radiographic, and laboratory measures. Ann Intern Med 1989, 110(4):259-266. 96. Salaffi F, Bazzichi L, Stancati A,< /b> Neri R, Cazzato M, Cons...
Ngày tải lên: 12/08/2014, 00:20
Tài liệu Báo cáo khoa học: "Generative Power of CCGs with Generalized Type-Raised Categories" pptx
... of < /b> lexical categories. For example, SkAkB \A\< /b> B \AkBkC may be derived from "SkAkBkC + + SkAkBkS + SkAkBkS" by '< ;B& apos;. b. Wrapping can occur only when GTRCs are invol- ... "cl (hi (b\ ak \a,< /b> )) + T/(T\ak \a,< /b> ) * c" where T = b. Since any argument category is bounded, we can add b/ (b\ ak \a~< /b> ) 6 f' (al a,< /b>...
Ngày tải lên: 22/02/2014, 03:20
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt
... TA CATATGCACCATCACCATCACCATATTGTTACACCATATA NdeI pIsaA5 TA CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoI IsaA3Myc TA GAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRI Rao C. V. ... in bold. Oligonucleotide Sequence (5¢-to3¢) Restriction site fl-SpsB5 TA CATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeI fl-SpsB3 TA GAATTCTTAATTTTTAGTATTTTCAGG EcoRI tr-SpsB5 TA CATATG...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... of < /b> Turin, supervisor: Carla Bazzanella). The author wants to thank her supervisor at ITC- IRST, Fabio Ciravegna, for his constant help. Alberto Lavelli provided valuable comments to the paper. ... language, i.e. it contains all the words of < /b> the language that do not belong to the FL. In general the quantity of < /b> application specific information is small. Any machine...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: "The effect of domain and text type on text prediction quality" pptx
... (Garay-Vitoria and Abascal, 2006). There is some variation among methods in the size and type < /b> of < /b> buffer used. Most methods use character n-grams as buffer, because they are pow- erful and can be implemented ... algorithm (Garay-Vitoria and Abas- cal, 2006). The performance that can be obtained by text prediction algorithms depends on the lan- guage they are evaluated on. Lower r...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: Identification of proNeuropeptide FFA peptides processed in neuronal and non-neuronal cells and in nervous tissue potx
... Matsumoto, Y.,Hosoya,M.,Fujii,R.,Watanabe,T.,Kikuchi,K.,Terao,Y., Yano, T., Yamamoto, T., Kawamata, Y., Habata, Y., Asada, M., Kitada, C., Kurokawa, T., Onda, H., Nishimura, O., Tanaka, M., Ibata, Y. & Fujino, ... 349–361. 28. Nakayama, K., Watanabe, T., Nakayama, T., Kim, W., Nagah- ama, M., Hosaka, H., Hatsuzawa, K., Kondoh-Hashiba, K. & Murakami, K. (1992) Consensus sequence for pr...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: "Protective effect of the isoflavone equol against DNA damage induced by ultraviolet radiation to hairless mouse skin" potx
...
Ngày tải lên: 07/08/2014, 18:21