Báo cáo khoa hoc:" Pregnancy in dialysis patients: a case series" ppt
... Central Page 1 of 4 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Pregnancy in dialysis patients: a case series Khalid A Al-Saran* and Alaa A Sabry Address: ... Sabry Address: Prince Salman Center for Kidney Diseases, Riyadh, Kingdom of Saudi Arabia Email: Khalid A Al-Saran* - khalid_aln@yahoo.co.uk; Alaa A Sabry - asab...
Ngày tải lên: 11/08/2014, 10:23
... BM: Anemia in the adult patient. Hospital Physician 2004, 32-36. 10. Kettaneh A, Eclache V, Fain O, Sontag C, Uzan M, Carbillon L, Stirnemann J, Thomas M: Pica and food craving in patients with ... obesity: a new presentation of an old problem. J Am Diet Assoc 2004, 104:1393-1397. 3. Grotegut CA, Dandolu V, Katari S, Whiteman VE, Holtzman OG, Teitelman M: Baking soda pica: a case o...
Ngày tải lên: 11/08/2014, 12:20
... concha bullosa polyp in a 45-year-old man. The clinical presentation, radiological and endoscopic findings, and management approach for this case are discussed. Case presentation A 45-year-old man ... Edited by: Yanagisawa E. San Diego, Singular- Thompson Learning; 2000. 2. Mirante JP, Christmas DA, Yanagisawa E: Polyps arising in a con- cha bullosa of the middle turbinate. Ear...
Ngày tải lên: 11/08/2014, 23:22
báo cáo khoa học: " Pseudoclavibacter-like subcutaneous infection: a case report" ppt
... antibiotic treatment combining intravenous imipenem and vanco- mycin. Oral treatment with amoxicillin/clavulanate replaced intravenous antibiotics on day six. Identification of the isolate was made possible ... organisms are organisms involved in skin diseases. Pseudoclavibacter-like organ- isms are bacterial organisms identifiable in cutaneous andsubcutaneousinfectionsinhumansonthebasiso...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: " Benign multicystic peritoneal mesothelioma: a case report" pptx
... signs and symptoms. A clinical examination reveal ed a painful palpable mass in her left abdomen. Abdominal ultrasonography and computed tomography demonstrated the presence of a large cystic mass ... CT axial image after the intravenous administration of a contrast medium demonstrating an intra-peritoneal hypodense non-enhancing mass adjacent to the stomach and spleen. Pitta et al....
Ngày tải lên: 11/08/2014, 02:22
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx
... 353 AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354 ATATATGGATCCATGGGCTGGATTCCGTGTC ... H409L GGAGTGTCCTTCTATAACATA TTTGGAGTGTCACTTAATACACC Y346F GTCACTATCATCTCCCAT GCAATGGGAGGACTTATGGTTTC S17 7A CATATGTAGATGGAGCTGGAACTGTCCCTG D38 4A GGAGTGTCACTTAAT GCACCCTTTGATGTTTG T35 2A 37...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: "Suicide in deaf populations: a literature review" ppsx
... Glickman, 2006 Prevalence study To examine demographic and clinical characteristics of deaf and hearing psychiatric in- patients A total of 64 deaf adult patients of specialist deaf unit at Westborough ... day in March 2006. The Clinical Evaluation of Risk and Functioning Scale, revised. The Allen Cognitive Levels Scale. Language Rating Scale. Deaf psychiatric inpatients rated at...
Ngày tải lên: 08/08/2014, 23:20
Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx
... ML, Kader AS, Beckham WA, Olivotto IA: Target volume delineation for partial breast radiotherapy planning: clinical characteristics associated with low interobserver concordance. Int J Radiat ... respiratory gating. Lung Cancer 2006,51:41-51. 15. Kepka L, Bujko K, Garmol D, Palucki J, Zolciak-Siwinska A, Guzel-Szczepiorkowska Z, Pietrzak L, Komosinska K, Sprawka A, Garbaczewska A: Deli...
Ngày tải lên: 09/08/2014, 09:21
báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf
... collaborators from the project's inception, including provincial health minis- tries, national health information, patient safety, and accreditation bodies, and provincial and federal funding partners ... tex- tual data; understanding and comparing across several sources of data, synthesizing the data to capture mean- ings, constructing theoretical relationships from the data, and explai...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " Globalisation of birth markets: a case study of assisted reproductive technologies in India" pptx
... technologies and a growing compliance with international quality stan- dards, as well as the fact that foreigners are less likely to face language barriers in India. Whereas the cost of treatment in other ... industry in India [19]. While official statistics on the n umber of surrogacies being arranged in India are not availab le, anecdotal evidence sugges ts a sharp increase. Acc...
Ngày tải lên: 11/08/2014, 14:21