Báo cáo khoa hoc:" Traumatic avulsion of kidney and spleen into the chest through a ruptured diaphragm in a young worker: a case report" pot

... not rare, the avulsion of both kidney and spleen following abdom- inal trauma is very uncommon. The authors describe a case of traumatic avulsion of kidney and spleen into the chest through a ruptured ... Herniation of adjacent intrathoracic and intra-abdominal organs through a dia- phragmatic tear is a relative rare phenomenon and depen...

Ngày tải lên: 11/08/2014, 10:22

... DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢,5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢,5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and ... [5] a The slow phase of the L99F mutant was independent of the O 2 concentration. b Measurement of the rate of O 2 binding was not feasible because of low heme binding af...

Ngày tải lên: 16/03/2014, 13:20

... water- logging period, under saturating CO 2 and irra- diance to estimate the photosynthetic capacity (A max ) of the leaves. Seedlings were harvested thereafter, and biomass and ... sensitivity to waterlogging among genotypes. Shading of the seedlings interacted with waterlogging and limited the extent of induced damage. In particular, s...

Ngày tải lên: 08/08/2014, 18:21

... 5'GGCCGCTAGCAAA- GAAGATCCCCTTAAAAAATATACTT; and 5'GGCCGCTAGCATTCCAGTCCTCCAAAATAGT; del2: 5'GGCCGCTAGCCATACACCTCCAGCACCTAAAGAA- GATC; and 5'GGCCGCTAGCGCCTCCTGGAGGAGGTT- GTAAAC. The following ... proteins; and struc- tural constraints induced by the juxtaposition of several proline residues following internal h4 deletion. In contrast, the deletion of the...

Ngày tải lên: 12/08/2014, 04:22

... aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities. In the rat, gluconeogenesis from l-serine takes place mainly through l-serine dehydratase, whereas the flux through ... bisphosphatase and catalase, whereas liver enolase and carbonic anhydrase 3 were downregu- lated. Comparable amounts of b-actin were present in AgxtKO an...

Ngày tải lên: 23/03/2014, 03:20

... pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1 1 Department of Structural and ... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and perox...

Ngày tải lên: 15/02/2014, 01:20

... a- chain, tropomyosin b-chain, myosin regulatory light chain 2, myosin light chain 3, and parvalbumin -a. Analyses of mRNA have revealed that PPARa suppressed the genes encoding these proteins in a ... through increased binding of the Ternary Complex Factor (TCF), such as Elk-1, to the SRE and transcriptional activation, and activation of a histone kinase, such as...

Ngày tải lên: 19/02/2014, 07:20

... conserved amino acid residues in the 40 kDa protein. Using the Rhodobacter capsulatus 40 and 70 kDa magnesium chelatase subunits we have analysed the effect of these mutations. Although having no ATPase ... xantha-h mutants could be that the XAN-H protein affects the level of Xantha-g mRNA. Therefore, the presence of Xantha-g mRNA was analysed in one semidominant and...

Ngày tải lên: 19/02/2014, 12:20

... subsequent experiments. Construction of cDNAs encoding the H. japonicus and T. scyllia DNases I Total RNA was isolated from the pancreas of each shark using Sepasol-RNA I (Nacalai tesque, Kyoto, Japan). The 3¢-end region of the ... of amphibians [19]. As in a mphibian DNases I, the insertio n of an additional amino acid residue into the shark enzymes may be essen...

Ngày tải lên: 19/02/2014, 16:20

... of Scheme 1). (b) Maximal DA values are clearly increased in the presence of myristate, thereby indica- ting that binding of myristate to a modulatory site FAx increases the signal yield of the ... each composed of two (A and B) subdomains. The three domains have different binding capacity for a broad variety of ligands such as aminoacids (Trp and Cys), hormones...

Ngày tải lên: 20/02/2014, 02:22