Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot
... CentralPage 1 of 3(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case report Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance ... cytopenia-inducedHCV recurrence. With recovery of leucocytes the virus wasagain cleared spontaneously. These findings suggest thatagranulocytosis can lead to reactivation of hepatitis C virus and ... with elevated lipase and concomitant abdominalpain, an endoscopic retrograde cholangiopancreatogra-phy (ERCP) was performed. Trapped air in CT scan indi-cated a small perforation after papillotomy....
- 3
- 232
- 0
Báo cáo khoa hoc:" Reversal of isolated unilateral optic nerve edema with concomitant visual impairment following blunt trauma: a case report" potx
... optic canal. Contusion of theintracanalicular optic nerve axons and pial microvascula-ture leads to local optic nerve ischemia and edema. Ede-matous ischemic axons result in further neuralcompression, ... considered toreduce microvascular spasm and soft tissue edema via sta-bilization of the microvascular circulation and calciumhomeostasis, thereby enhancing bloodflow and reducingcell death. The study ... evidence still lacks a validated approach to the management of traumatic opticneuropathy and each case needs to be individuallyassessed. There is a need for a large, prospective, rand-omized controlled...
- 5
- 247
- 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
... amplified by PCR from pHCV7 7c using forward (5'-gcgcgcggatccgccagccccct-gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac-cgctcggaagtcttcc-3') oligonucleotides, and cloned ... cloning 1 or 3 copies of the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT(5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3')binding sites into the PmeI site of ... expression vector was conceived bycloning in psiSTRIKE the pre-mmu-miR-328 sequence(5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagcccctggccctctctgcccttccgtcccctgt ttttc-3') (Promega)....
- 13
- 362
- 0
Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc
... clinical characteristics, demographiccharacteristics and social behaviors, which could be possi-ble risk factors to acquiring HCV.Statistical AnalysisGeneral descriptive analysis was used to analyze ... this scenario it has become very necessaryfor a screening exercise to determine the prevalence rate of HCV among diabetic patients so as to increase awareness of the populace and health practitioners ... Ndako* - ndakoj@yahoo.co.uk; Georgebest O Echeonwu - gon612echeonwu@yahoo.com; Nathaniel N Shidali - shidalinn@yahoo.com; Iliyasu A Bichi - iliyasubichi@yahoo.com; Grace A Paul - graceabu@yahoo.com;...
- 5
- 463
- 0
Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc
... conceived of the study and carried out the study design, and drafting of the manuscript. IB carried out the immu-noassays, participated in data collection and Statisticalanalysis. GE Participated ... serum.QuestionnaireStructured questionnaire were administered to the sub-jects, which covers clinical characteristics, demographiccharacteristics and social behaviors, which could be possi-ble risk factors to acquiring ... so as to increase awareness of the populace and health practitioners on the dangers of the co-infectious state of this virus with diabetes.Materials and methodsOur study was carried out according...
- 5
- 209
- 0
báo cáo khoa học: " Primary extranodal soft-tissue B-cell lymphoma with abundant immunoglobulin inclusions mimicking adult rhabdomyoma: a case report" potx
... this case. ConclusionWe report a rare case of low-grade B-cell lymphomawith abundant intracellular Ig accumulation. Thepatient’s clinical presentation and MRI suggested a soft-tissue tumor, and ... be an out-come of impaired cell secretory activity, leading to Igsaccumulation. It also may be associated with the excessproduction of a monoclonal Ig. It is not unusual that B-cell-associated ... diseases [1,7].Finally, a special low-grade lymphoplasmacytic lym-phoma with abundant intracytoplasmic Ig inclusions wasdemonstrated on the basis of immunohistochemical,ultrastructural and...
- 3
- 304
- 0
Báo cáo khoa hoc:" Giant hepatic hydatid cyst with sub-fascial extension treated by open minimally invasive surgery: a case report" potx
... minimum breaching of the peritoneal cavity using a laparoscopic trocar toevacuate the cyst.Conclusion: The use of a laparoscopic trocar through a small abdominal incision in selectedpatients ... (puncture, aspiration, injection, re-aspira-tion) [5-7] and PEVAC (percutaneous evacuation of cystcontent) [8] for treating hepatic echinococcosis. An array of surgical procedures has been recommended. ... AbstractIntroduction: Hepatic hydatid disease can be successfully treated by a variety of modalities. Case Presentation: We report a case of a 60 year old male with giant hepatic hydatid diseasewho...
- 5
- 277
- 0
Báo cáo khoa học: " Seroprevalence of Hepatitis B virus and Hepatitis C virus among blood donors in Nyala, South Dar Fur, Sudan" ppsx
... immuno-chromatographic test (ICT) from Advanced Quality, thenscreened with a 3rd generation ELISA, Equi-HBsAg and EIAgen anti-HCV antibodies from Equibar and Adalitsrespectively.Statistical AnalysisProcessing ... AnalysisProcessing and analysis of data were performed by means of the statistical package for social sciences (SPSS-PC ver-sion 10.0, computer software). Statistical significance wastaken as (P ... Kok FJ: The role of hepatitis B and hepatitis C viral infec-tions in incidence of hepatocellular carcinoma in Sudan.Transactions of the Royal Society of Tropical Medicine and Hygiene 2001,95:487-491.4....
- 4
- 436
- 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... Tajima K. An epidemiological study of HBV, HCV, and HTLV-1 in Sherpas of Nepal. Asian Pac J Cancer Prev. 2004; 5(4):370-3. 30. Panigrahi AK, Panda SK, Dixit RK, Rao KV, Acharya SK, Dasarathy ... F, Costantino A, Rapicetta M, Lecce R, Taliani G. High prevalence of hepatitis C virus infection in a small central Italian town: lack of evidence of parenteral exposure. Ital J Gastroenterol ... world. Incidence rates across the world fluctuate and are difficult to calculate given the asymptomatic, often latent nature of the disease prior to clinical presentation. Prevalence rates across...
- 6
- 486
- 0
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx
... Ultrastructural and physicochemical characterization of the hepatitis C virus recovered from the serum of an agammaglobulinemicpatient. Arch Virol 143, 2241–2245.28 Kanto T, Hayashi N, Takehara ... Scarselli E, Ansuini H, Cerino R, Roccasecca RM,Acali S, Filocamo G, Traboni C, Nicosia A, Cortese R& Vitelli A (2002) The human scavenger receptor classB type I is a novel candidate receptor ... following sectiondescribes the advantages and disadvantages of theseparticles for infectivity assays.Clinical isolatesThe use of clinical isolates in infectivity assays has theadvantage that these...
- 15
- 570
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI