Báo cáo khoa hoc:" Therapy-refractory Panton Valentine Leukocidin-positive community-acquired methicillin-sensitive Staphylococcus aureus sepsis with progressive metastatic soft tissue infection: a case report" pot
Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx
... GluV8 (Met1-Ala336) was amplified with a pair of primers (5¢- ATGGGATCCAAAGGTAAATTTTTAAAAGTTAGTT CT-3¢ and 5¢-ATTGGATCCCTGAATATTTATATCAGG TATATTG-3¢) and then processed as described above. T. K. ... (Met1-Gln282) was amplified with a pair of prim- ers: 5¢-TATGGATCCAAAAAGAGATTTTTATCTATATG TAC-3¢ and 5¢-ATTGGATCCCTGAATATTTATATCAG GTATATTG-3¢. BamHI sites introduced in the primers are indi...
Ngày tải lên: 16/03/2014, 06:20
báo cáo khoa học: "Correction: Endocarditis caused by methicillin-susceptible Staphylococcus aureus with reduced susceptibility to vancomycin: a case report" ppt
... (hugodandrea@ciudad.com.ar) Natalia Bello (nataliasbello@yahoo.com.ar) Marta Mollerach (martamollerach@gmail.com) Carlos Vay (cavay@fibertel.com.ar) Maria Beatriz Lasala (mblasala@fibertel.com.ar) Angela Famiglietti ... methicillin-susceptible Staphylococcus aureus with reduced susceptibility to vancomycin: a case report Journal of Medical Case Reports 2011, 5:555 doi:10.1186/1752...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo khoa học: "Rapid molecular detection of methicillin-resistant Staphylococcus aureus: a cost-effective tool for infection control in critical care" pdf
... isolation precautions are taken. To address this diagnostic delay, a cautious alternative is to place ICU-admitted patients in pre- emptive isolation until proven MRSA-negative. Technological advances ... and methicillin-resistant coagulase-negative staphylococci [9]. Clinical evaluations of this assay have shown that MRSA could be detected from nasal swabs within 2 hours with high sensit...
Ngày tải lên: 12/08/2014, 23:22
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... (F) CGCCAATTGATGCAAGAACATCATGTT; (R) AAAA CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG. MfeI and PstI sites were inserted in for- ward and reverse primers, respectively, upstream and down- stream ... two days. As a control, cells were plated on a Luria–Bertani agar medium containing ampicillin and appropriate IPTG concentrations and incubated at 37 °C overnight. Flavin analysis The natur...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc
... α-flag 62 48 37 26 19 62 48 37 26 19 15 62 48 37 26 19 HA-Sav HA-Sav PPIA flag-Sav flag-Sav * * 123456 flag-Sav WT flag-Sav Δ199 HA-Sav WT flag-CrmA-DQMD flag-Sav Δ268 flag-Sav Δ321 HA-PPIA Fig. 4. hSalvador can homo-multimerize independently ... QLD, Australia). Plasmids and cDNAs The mammalian expression plasmid, pcDNA3 (Invitrogen, Melbourne, VIC, Australia), containing N-terminally flag- t...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Processing, catalytic activity and crystal structures of kumamolisin-As with an engineered active site pptx
... Ashida M, Minakata H, Oyama H, Oda K, Nishino T & Nakayama T (2004) Crystallographic and biochemical investigations of kumamolisin-As, a serine-carboxyl pep- tidase with collagenase activity. ... Tsuruoka N, Nakayama T, Ashida M, Hemmi H, Nakao M, Minakata H, Oyama H, Oda K & Nishino T (2003) Collagenolytic serine-carboxyl proteinase from Alicyclobacillus sendaiensis strain NTAP-1...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt
... SD)M 419 AAAA 428 [14] 5. GST-ExoS(LDL426–428AAA) S 419 QGLLDAAAA 428 This study 6. GST-ExoS(DALDL424–428AAAAA) S 419 QGLLAAAAA 428 This study 7. GST-ExoS(D42 4A; D42 7A) S 419 QGLLAALAL 428 This ... substituted with alanine and residues 424–428 have been deleted [14] (Fig. 1, compare lane 3 with lanes 2 and 4). We also observed that both GST-ExoS(DALDL424–428AAAAA) and GST-ExoS- (LDL426–...
Ngày tải lên: 19/02/2014, 08:20
Tài liệu Báo cáo khóa học: UDPgalactose 4-epimerase from Saccharomyces cerevisiae A bifunctional enzyme with aldose 1-epimerase activity docx
... 4-epimerase from Saccharomyces cerevisiae A bifunctional enzyme with aldose 1-epimerase activity Siddhartha Majumdar 1 , Jhuma Ghatak 2 , Sucheta Mukherji 2 , Hiranmoy Bhattacharjee 3 and Amar Bhaduri* 1 Division ... primer 5¢-TCAGGATCCACTTCTTTGCGTCCATCC-3¢ that introduced a BamHI restriction site and an antisense primer 5¢-CCACTGCAGTCAGGAAAATCTGTAGAC-3¢ that introduced a PstI restric...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... units. Caspases and inhibitors Caspase substrates and their inhibitors were purchased from Biomol. Ac-DEVD-AMC is a substrate for caspases 3 and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC ... is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9. Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC are tetra peptide substrates representing mdm-2,...
Ngày tải lên: 19/02/2014, 13:20
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢. ... Katayama, Y., Fujita, A. , Inageda, K., Tanemoto, M., Inanobe, A. , Yamashita, S., Matsuzawa, Y. & Kurachi, Y. (2000) C-terminal tails of sulfonylurea receptors con...
Ngày tải lên: 20/02/2014, 02:21