Báo cáo khoa hoc:" Hypercalcemia after transplant nephrectomy in a hemodialysis patient: a case report" pdf

... Central Page 1 of 5 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Hypercalcemia after transplant nephrectomy in a hemodialysis patient: a case ... tuberculin skin test in a renal transplant recipient. Am J Med 1986, 80(4):699-702. 8. Huart A, Kamar N, Lanau JM, Dahmani A, Durand D, Rostaing L: Sar- coidosis-rela...

Ngày tải lên: 11/08/2014, 10:22

... nodal involvement as determined by physical examination, imaging and endoscopy. Although clinical staging before treatment was similar in the two groups, pathologic staging (according to the AJCC ... 7 RESULTS Patient demographics and Clinical characteristics Patient demographics and clinical characteristics are outlined in Table 1. The group included 277 men and 100 women. The medi...

Ngày tải lên: 09/08/2014, 02:21

... place. Initial oesophageal Doppler studies in this patient indicated a high cardiac index and vasodilatation. Despite subsequent administration of NAC (a hyperosmolar solution that is associated ... lungs and heart, with an associated sero-haemor- rhagic pleural effusion, acute tubular necrosis and significant gastrointestinal irritation and haemorrhage. In the case reported here, th...

Ngày tải lên: 12/08/2014, 22:21

... messages • Ibuprofen is a NSAID used as an analgesic, as an anti- pyretic agent and as an anti-inflammatory agent. • Most patients with ibuprofen overdoses are usually asymptomatic or have mild ... sustained-release case would support the use of multidose activated charcoal in the management of patients who have ingested a sustained- release preparation of ibuprofen in any subseque...

Ngày tải lên: 12/08/2014, 23:22

... counter (LKB, Wallac, Finland). All animals were maintained and handled according to local and national ethical guidelines. Animal model of septic shock Two groups, each containing 40 female NMRI mice ... by a long-last- ing blood meal, leaving time for its host to activate defensive reactions such as pain (stimulating scratch- ing) and hemostasis (repairing the wound and involv- ing coagul...

Ngày tải lên: 07/03/2014, 01:20

... MMPIs. Abbreviations ADAM, a disintegrin and metalloproteinase; ADAMTS, a disintegrin and metalloproteinase with thrombospondin motifs; bFGF, basic fibroblast growth factor; ECM, extracellular matrix; ... carcinogenesis in mice. Science 284, 808–812. 81 Konstantinopoulos PA, Karamouzis MV, Papatsoris AG & Papavassiliou AG (2008) Matrix Metalloprotein- ase inhibitors as anticancer age...

Ngày tải lên: 15/03/2014, 00:20

... laying that is involved in forming and maintaining egg-laying and mating aggregations in Aplysia [6–9]. The disulfide- bonding pattern and NMR solution structure indicated that attractin has a ... signaling pathway that may have evolutionary significance. Binary combinations of attractin and temptin are sufficient to stimulate mate attraction and are thought to act in concert with entici...

Ngày tải lên: 16/03/2014, 05:20

... the stator arginine and the c-ring. These biochemical results and structural restraints support a model in which the stator arginine operates as a pendulum, moving in and out of the binding pocket ... sub- unit a and the c-ring were made several years ago by Fillingame et al. They presented an elaborate study on the interacting helical faces of subunits a and c of Escherichia coli...

Ngày tải lên: 16/03/2014, 06:20

... forward A5 5T CCATCAAGGTTTTGACCAAGGTTGCCGGTACC mutagenesis Lep d 2.01 reverse A5 5T GGTACCGGCAACCTTTGGTCAAAACCTTGATGG Lep d 2.02 forward A1 02V CCCCAAGATCAAGGTCGACGTCACCGCC Lep d 2.02 reverse A1 02V ... m M dNTP (Amersham Pharmacia Biotech) and 5 lL10· Pfu PCR-buffer (Stratagene, La Jolla, CA, USA). After denaturation at 98 °C for 10 min, 2.5 U of Pfu polymerase (Stratagene) was added....

Ngày tải lên: 17/03/2014, 09:20

... upregulation gradually increases as a function of time, and reaches maximal levels after 48 h of hyp- oxia in brain, heart, and liver. For muscle, the highest upregulation is also obtained after ... Fago et al. [10] described a mathematical model of ret- inal O 2 supply that argues that Ngb plays a role in scavenging ROS and reactive nitrogen species that are generated following...

Ngày tải lên: 23/03/2014, 09:21