Báo cáo khoa hoc:" Hypercalcemia after transplant nephrectomy in a hemodialysis patient: a case report" pdf
Báo cáo khoa hoc:" Hypercalcemia after transplant nephrectomy in a hemodialysis patient: a case report" pdf
... Central
Page 1 of 5
(page number not for citation purposes)
Journal of Medical Case Reports
Open Access
Case report
Hypercalcemia after transplant nephrectomy in a hemodialysis
patient: a case ... tuberculin skin test in
a renal transplant recipient. Am J Med 1986, 80(4):699-702.
8. Huart A, Kamar N, Lanau JM, Dahmani A, Durand D, Rostaing L: Sar-
coidosis-rela...
báo cáo khoa học: "Complications after radical gastrectomy following FOLFOX7 neoadjuvant chemotherapy for gastric cancer" pdf
... nodal involvement as determined by physical examination, imaging and
endoscopy. Although clinical staging before treatment was similar in the two groups,
pathologic staging (according to the AJCC ...
7
RESULTS
Patient demographics and Clinical characteristics
Patient demographics and clinical characteristics are outlined in Table 1. The group
included 277 men and 100 women. The medi...
Báo cáo khoa học: "Fatality after deliberate ingestion of the pesticide rotenone: a case report" docx
... place. Initial oesophageal Doppler
studies in this patient indicated a high cardiac index and
vasodilatation. Despite subsequent administration of NAC (a
hyperosmolar solution that is associated ... lungs and heart, with an associated sero-haemor-
rhagic pleural effusion, acute tubular necrosis and significant
gastrointestinal irritation and haemorrhage. In the case
reported here, th...
Báo cáo khoa học: "Fatality after deliberate ingestion of sustained-release ibuprofen: a case report" pdf
... messages
• Ibuprofen is a NSAID used as an analgesic, as an anti-
pyretic agent and as an anti-inflammatory agent.
• Most patients with ibuprofen overdoses are usually
asymptomatic or have mild ... sustained-release case
would support the use of multidose activated charcoal in the
management of patients who have ingested a sustained-
release preparation of ibuprofen in any subseque...
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... counter (LKB, Wallac, Finland). All animals were
maintained and handled according to local and national
ethical guidelines.
Animal model of septic shock
Two groups, each containing 40 female NMRI mice ... by a long-last-
ing blood meal, leaving time for its host to activate
defensive reactions such as pain (stimulating scratch-
ing) and hemostasis (repairing the wound and involv-
ing coagul...
Báo cáo khoa học: Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting pdf
... MMPIs.
Abbreviations
ADAM, a disintegrin and metalloproteinase; ADAMTS, a disintegrin and metalloproteinase with thrombospondin motifs; bFGF, basic
fibroblast growth factor; ECM, extracellular matrix; ... carcinogenesis in mice. Science 284,
808–812.
81 Konstantinopoulos PA, Karamouzis MV, Papatsoris
AG & Papavassiliou AG (2008) Matrix Metalloprotein-
ase inhibitors as anticancer age...
Báo cáo khoa học: Aplysia temptin ) the ‘glue’ in the water-borne attractin pheromone complex pdf
... laying that is
involved in forming and maintaining egg-laying and
mating aggregations in Aplysia [6–9]. The disulfide-
bonding pattern and NMR solution structure indicated
that attractin has a ... signaling
pathway that may have evolutionary significance.
Binary combinations of attractin and temptin are
sufficient to stimulate mate attraction and are
thought to act in concert with entici...
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt
... the stator arginine and the c-ring. These biochemical results and
structural restraints support a model in which the stator arginine operates
as a pendulum, moving in and out of the binding pocket ... sub-
unit a and the c-ring were made several years ago by
Fillingame et al. They presented an elaborate study on
the interacting helical faces of subunits a and c of
Escherichia coli...
Báo cáo khoa học: Lep d 2 polymorphisms in wild and cultured Lepidoglyphus destructor mites pdf
... forward A5 5T CCATCAAGGTTTTGACCAAGGTTGCCGGTACC
mutagenesis Lep d 2.01 reverse A5 5T GGTACCGGCAACCTTTGGTCAAAACCTTGATGG
Lep d 2.02 forward A1 02V CCCCAAGATCAAGGTCGACGTCACCGCC
Lep d 2.02 reverse A1 02V ... m
M
dNTP (Amersham Pharmacia Biotech) and
5 lL10· Pfu PCR-buffer (Stratagene, La Jolla, CA,
USA). After denaturation at 98 °C for 10 min, 2.5 U of
Pfu polymerase (Stratagene) was added....
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc
... upregulation gradually increases as a function
of time, and reaches maximal levels after 48 h of hyp-
oxia in brain, heart, and liver. For muscle, the highest
upregulation is also obtained after ... Fago et al. [10] described a mathematical model of ret-
inal O
2
supply that argues that Ngb plays a role in
scavenging ROS and reactive nitrogen species that are
generated following...
Từ khóa: