Báo cáo khoa hoc:" Chylous ascites associated with chylothorax; a rare sequela of penetrating abdominal trauma: a case report" ppt

Báo cáo khoa hoc:" Chylous ascites associated with chylothorax; a rare sequela of penetrating abdominal trauma: a case report" ppt

Báo cáo khoa hoc:" Chylous ascites associated with chylothorax; a rare sequela of penetrating abdominal trauma: a case report" ppt

... accumulation of fluid and increase in abdominal girth. As the abdominal distension progresses dyspnea, nausea and vague abdominal pain associated with paralytic ileus may occur. Hypovolumia from contin- ued ... outpatient follow-up. Discussion Chylous ascites is the accumulation of extravasated chyle in the peritoneal cavity. Chylous ascites is milky in appearance and se...

Ngày tải lên: 11/08/2014, 10:22

3 336 0
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... (CAGGACAGCCTGCGCAACGAG), RVR (CAG GACAGGGTGCGCAACGAG), SVR (CAGGACAG CGTGCGCAACGAG) and SLC (AGGGTATCCCTC TGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... the stability of the protein was affected by each of the mutations Table 4. Apparent a nity of DDT and testosterone for CYP 6A2 wt and CYP 6A2 vSVL. For each apparent a nity calculated, the...

Ngày tải lên: 19/02/2014, 12:20

8 535 0
Báo cáo khoa học: Endogenous tetrahydroisoquinolines associated with Parkinson’s disease mimic the feedback inhibition of tyrosine hydroxylase by catecholamines doc

Báo cáo khoa học: Endogenous tetrahydroisoquinolines associated with Parkinson’s disease mimic the feedback inhibition of tyrosine hydroxylase by catecholamines doc

... substantia nigra and corpus striatum of patients with PD are unknown, a recent analysis indicated that the average concentration of NMSal in the substantia nigra, caudate nucleus and putamen of individuals ... sulfate. Statistical analysis Data are given as mean ± SEM. Mean differences between hTH activities in the absence and presence of PKA were analyzed by an unpaired t test. W...

Ngày tải lên: 07/03/2014, 05:20

13 487 0
Báo cáo khoa học: "Pelvic mass associated with raised CA 125 for benign condition: a case report" potx

Báo cáo khoa học: "Pelvic mass associated with raised CA 125 for benign condition: a case report" potx

... be associated with pelvic mass and a raised CA 125. Case presentation: We present a case of 19 year old, Caucasian British woman who presented initially with sudden onset right sided iliac fossa ... especially in premenopausal women. Case presentation A 19 year old nulliparous, British Caucasian woman was admitted with a sudden onset of right iliac fossa pain. Urine...

Ngày tải lên: 09/08/2014, 03:21

3 416 0
Báo cáo khoa học: "Gallbladder perforation associated with carcinoma of the duodenal papilla: a case report" pdf

Báo cáo khoa học: "Gallbladder perforation associated with carcinoma of the duodenal papilla: a case report" pdf

... Ultrasound 2002, 30:270-4. 10. Ishihara S, Miyakawa S, Takada T, Takasaki K, Nimura Y, Tanaka M, Miyazaki M, Nagakawa T, Kayahara M, Horiguchi A: Status of surgical treatment of biliary tract ... inflammatory change of its wall (a) . The tumor of the papilla was well-differentiated tubular adenocarcinoma with a maximum diameter of 1.3 cm (b, c). a b c Hosaka et al. World...

Ngày tải lên: 09/08/2014, 03:21

3 312 0
Báo cáo khoa học: "Colorectal carcinoma associated with schistosomiasis: a possible causal relationship" ppsx

Báo cáo khoa học: "Colorectal carcinoma associated with schistosomiasis: a possible causal relationship" ppsx

... Matsuda K, Masaki T, Ishii S, Yamashita H, Watanabe T, Nagawa H, Muto T, Hirata Y, Kimura K, Kojima S: Possible associations of rectal carcinoma with schistosoma japonicum infection and membranous ... Uthman S, Farhat B, Farah S, Uwayda M: Association of Schistosoma mansoni with colonic carcinoma. Am J Gastroenterol 1991, 86(9):1283-1284. 21. Al-Mashat F, Sibiany A, Radwi A, Bahadur...

Ngày tải lên: 09/08/2014, 03:22

6 300 0
báo cáo khoa học: "Eosinophilic pneumonia associated with daptomycin: a case report and a review of the literature" pptx

báo cáo khoa học: "Eosinophilic pneumonia associated with daptomycin: a case report and a review of the literature" pptx

... there have been a few case reports of severe pulmonary complications associated with daptomycin administration. Case presentation: A rare case of eosinophilic pneumonia occurring 10 days after daptomycin ... laboratory data and radiologic findings [13]. Patients with EP normally have cough and dyspnea for several days or weeks and may have a rash and/or fever. In acute...

Ngày tải lên: 11/08/2014, 03:20

5 375 0
Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf

Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf

... Central Page 1 of 2 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: ... pancreatitis: a case report Ulfin Rethnam* and Rajam Sheeja Yesupalan Address: Department of Orthopaedics, Glan Clwyd Hospital, Rhyl, UK Email: Ulfin Rethnam* - ulfi...

Ngày tải lên: 11/08/2014, 10:22

2 318 0
Báo cáo khoa hoc:" Chylous ascites following radical nephrectomy: a case report" ppsx

Báo cáo khoa hoc:" Chylous ascites following radical nephrectomy: a case report" ppsx

... patient records, data and drafted the manu- script. KA participated in acquisition of data. RS participated in acquisition of data. RM participated in acquisition of data. PA participated in acquisition ... etiological factors can be broadly classified as congenital, infective, neoplas- tic and traumatic or post surgical. The majority of cases are caused by diseases that interfere wi...

Ngày tải lên: 11/08/2014, 10:22

5 260 0
báo cáo khoa học: " Genomic variants associated with primary biliary cirrhosis" pptx

báo cáo khoa học: " Genomic variants associated with primary biliary cirrhosis" pptx

... Komori A, Yokoyama T, Ueki T, Daikoku M, Yano K, Matsumoto T, Migita K, Yatsuhashi H, Ito M, Masaki N, Adachi H, Watanabe Y, Nakamura Y, Saoshiro T, Sodeyama T, Koga M, Shimoda S, Ishibashi H: Antibody ... 118:145-151. 68. Pares A, Guanabens N, Alvarez L, De Osaba MJ, Oriola J, Pons F, Caballeria L, Monegal A, Salvador G, Jo J, Peris P, Rivera F, Ballesta AM, Rodes J: Collagen type Ia...

Ngày tải lên: 11/08/2014, 12:20

8 435 0
Từ khóa:
w