Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf
... Central Page 1 of 2 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: ... reaction after a single intravenous dose of 50 mgs of ranitidine and highlights this unusual but life threatening adverse reaction. The patient: A 56 y...
Ngày tải lên: 11/08/2014, 10:22
... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGAT- CCCGCGAAATTAATAC and TEHA8: ACACCCATGG- TATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI...
Ngày tải lên: 06/03/2014, 01:20
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Normalization of prostate specific antigen in patients treated with intensity modulated radiotherapy for clinically localized prostate cancer" pot
... to PSA normalization. Thequantitativedataareexpressedasthemean± SEM. Ordinal data are expressed as the median, w ith the range in parentheses. Times to PSA normalization were calculated using ... prostate cancer include radical prostatectomy, external beam radiation therapy, brachytherapy, and active surveillance. Both external beam radiation therapy (EBRT) and brachytherapy may be combined...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: "The analysis of quantitative variation in natural populations with isofemale strains" pptx
... affecting quantitative variation Data from several isofemale strain studies have been interpreted as indicating that a large percentage of the quantitative variation in morphological ... an analysis of variance (ANOVA), the between-line component of variance contains a quarter of the additive genetic variance and a quarter of the dominance var...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: " ’It’s risky to walk in the city with syringes’: understanding access to HIV/AIDS services for injecting drug users in the former Soviet Union countries of Ukraine and Kyrgyzstan" ppt
... substantially to the analysis and interpretation of data. All authors participated in manuscript writing and have read and approved the final manuscript. Competing interests The authors declare ... Republican AIDS Centre: 2007. 11. Murzalieva G, Kojokeev K, Samiev A, Aleshkina J, Kartanbaeva N, Botoeva G, Ablezova M, Jakab M: Tracking Global HIV/AIDS Initiatives and the Impact on the healt...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf
... Ca 2+ paradox Paradoxical Ca 2+ increases were originally described in isolated heart preparations [195] and subsequently shown to be associated with tissue damage in this and other organs, including ... Molina JA, Hernanz A, Fernan- dez-Vivancos EBF, Barcenilla B, Gomez-Escalonilla C, Zurdo M, Berbel A & Villanueva C (1999) Cerebro- spinal fluid levels of thiamine in patients...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf
... & Howell, P.L. (1999) Mutational analysis of amino acid residues involved in arginino- succinate lyase activity in duck dII-crystallin. Biochemistry 38, 2435–2443. 30. Sampaleanu, L.M., Davidson, ... disturbance Fig. 6. Diagram of the surface of duck d-crystallin (1AUWÆpdb). (A) Each subunit of the tetrameric d-crystallin shows a surface with several convex and concave areas as in...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: "Identifying Syntactic Role of Antecedent in Korean Relative Clause Using Corpus and Thesaurus Information" pdf
... the case particle of an antecedent, that indicates the syntactic role in the relative clause, is omitted during relativization. In fact, in a relatively free-word order language, the case particles ... will describe an approach to acquiring statistical information at conceptual level rather than at lexical level from a corpus using conceptual hierarchy in the Kadokawa t...
Ngày tải lên: 17/03/2014, 07:20
Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps
... penduncle’ — the ’sinus-veins’ and ’clustered hairs’ show a small overlap and therefore have more diagnostic value. In literature (reviewed in Aas, 1988), the distinction ... reliable distinctive feature. According to Flora Eu- ropaea (Tutin et al, 1964), it is up to 5 mm in pedunculate oak and between 18 and 25 mm in sessile oak....
Ngày tải lên: 08/08/2014, 19:21