Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx

Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx

Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx

... obtained. References 1. Matzkin E, Singer DI: Scaphoid stress fracture in a 13 year old gymnast: A case report. J Hand Surg (Am) 2000, 25(4):710-3. 2. Hanks GA, Kalenak A, Bowman LS, Sebastanelli ... reviewing the literature and drafted the manuscript as the main author. RSUY was involved in reviewing the literature and proof reading of the manuscript. RSUY has approved the...

Ngày tải lên: 11/08/2014, 10:22

2 222 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... Rome, Italy 4. Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy 5. Department of Dental Sciences and Surgery, University of Milano, Milano, Italy 6. Department of Medical Genetic, ... 4.8 and 4.9, after a routine hema- tological investigation and after the assessment of radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Sca n (Fig. 6) of...

Ngày tải lên: 25/10/2012, 11:40

7 598 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx

Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx

... WSM. Glycosaminoglycan analysis Glycosaminoglycans are highly negatively charged because of the presence of sulfate ester and/or carboxyl groups. Therefore, they interact with cations and are precipitated ... Organic matrix from carbonate biomineral as a regulator of mineralization. In Chemical Aspects of Regulation of Mineralization (Sikes,C.S.& Wheeler, A. P., eds). Unive...

Ngày tải lên: 21/02/2014, 01:21

10 732 0
Báo cáo y học: "Serum keratan sulfate transiently increases in the early stage of osteoarthritis during strenuous running of rats: protective effect of intraarticular hyaluronan injection" docx

Báo cáo y học: "Serum keratan sulfate transiently increases in the early stage of osteoarthritis during strenuous running of rats: protective effect of intraarticular hyaluronan injection" docx

... S, Nawata M, Kawaguchi A, Okabe T, Takaoka K, Tsuch- iya T, Nakaoka R, Masuda H, Miyazaki K: Serum keratan sulfate is a promising marker of early articular cartilage breakdown. Rheumatology (Oxford) ... defects of rat articular carti- lage [6]. In normal articular cartilage, hyaluronan was stained mainly around the chondrocytes. During repair, strong hyaluro- nan staining was observe...

Ngày tải lên: 09/08/2014, 10:22

8 371 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

... Sense: ACAGATGATGACACTGCCACC Antisense: CATAGTAGAGATATGGAGTGCTGC 55 324 35 Internal control EF1α Sense: AGGTGATTATCCTGAACCATCC Antisense: AAAGGTGGATAGTCTGAGAAGC 54 234 25 rt: primer pairs, that have ... ACGCCGACCAAGGAAAACTC Antisense: GTCCATAAACCACACTATCACCTCG 51 483 35 ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC 51 454 IHH Sense: GAGGAGTCCCTGCATTATGA Antisens...

Ngày tải lên: 09/08/2014, 14:22

15 830 0
Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx

Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx

... dithiothreitol). Radioactivities of lysatesweredeterminedbyaCobraIIauto-gamma counter (Packard BioScience, Dreieich, Germany). b- Galactosidase activities of cell lysates were analyzed by mixing cell lysates ... hours later, the iodide uptake activity was analyzed by steady-state iodide uptake assay and the transfection efficiency was monitored by b-galactosidase assay. As shown in Figu...

Ngày tải lên: 10/08/2014, 05:21

9 398 0
Báo cáo y học: " Mixed states vs. pure mania in the french sample of the EMBLEM study: results at baseline and 24 months – European mania in bipolar longitudinal evaluation of medication" ppsx

Báo cáo y học: " Mixed states vs. pure mania in the french sample of the EMBLEM study: results at baseline and 24 months – European mania in bipolar longitudinal evaluation of medication" ppsx

... EMBLEM Adversory Board: Olanzapine monotherapy and olanzapine combination therapy in the treatment of mania: 12-week results from the European Mania in Bipolar Longitudinal Evaluation of Medication (EMBLEM) ... atypical antipsychotic treatment maintained it, 36% for anticonvulsants, 45% for lithium and 20% for typical antipsychotics. 35% of the patients taking antide- pressants at b...

Ngày tải lên: 11/08/2014, 17:20

9 482 0
Báo cáo y học: "Mitochondrial dysfunction and mitophagy activation in blood mononuclear cells of fibromyalgia patients: implications in the pathoge"nesis of the disease potx

Báo cáo y học: "Mitochondrial dysfunction and mitophagy activation in blood mononuclear cells of fibromyalgia patients: implications in the pathoge"nesis of the disease potx

... the presence of mitophagy in BMCs of FM patients. Autophagy is a regulated lysosomal pathway involved in the degradation and recycling of cytoplasmic materials [38- 42]. During autophagy, cytoplasmic materials ... stiffness. They were sedentary peo- ple. Routine laboratory tests yielded normal results for glu- cose, urea, uric acid, total protein, creatinine, aspartate aminotransf...

Ngày tải lên: 12/08/2014, 11:22

11 288 0
Báo cáo y học: "Coming together to document mortality in conflict situations: proceedings of a symposium" docx

Báo cáo y học: "Coming together to document mortality in conflict situations: proceedings of a symposium" docx

... immediate use for humanitarian programming (Bethany Lacina, Stanford/ PRIO) [22]. Though it may serve as a valuable evidence for humanitarian intervention, the utilization of mortality data to make ... analyses of causes of death and investigations into the abuses of those who have perished. This overlap is not exactly a coincidence. Mortality is the ultimate indicator of human...

Ngày tải lên: 13/08/2014, 13:21

5 263 0
Báo cáo y học: "Early drotrecogin alpha (activated) administration in severe sepsis is associated with lower mortality: a retrospective analysis of the Canadian ENHANCE cohort" ppsx

Báo cáo y học: "Early drotrecogin alpha (activated) administration in severe sepsis is associated with lower mortality: a retrospective analysis of the Canadian ENHANCE cohort" ppsx

... sepsis Our initial analysis revealed that in patients administered DrotAA, two baseline measures of severity – mean number of organ dysfunctions and APACHE II score – and two dynamic laboratory measures ... However, delays in initiating treatment with DrotAA in Canada are com- mon – in a registry of 4087 Canadian intensive care patients (1269 with severe sepsis), t...

Ngày tải lên: 13/08/2014, 16:20

10 310 0
w