Báo cáo y học: "The skiers knee without swelling or instability, a difficult diagnosis: a case report" potx
Báo cáo y học: "The skiers knee without swelling or instability, a difficult diagnosis: a case report" potx
... Medical Case Reports Open Access Case report The skiers knee without swelling or instability, a difficult diagnosis: a case report Mark E O'Donnell* 1,4 , Stephen A Badger 1 , David Campbell 2 , ... higher rate occurs among skiers aged 55–64 when injury analysis is completed correlating for the actual number of participants for each age group [1]. The clinic...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... erik.zakariassen@isf.uib.no 1 National Centre for Emergency Primary Health Care, Uni Health, Bergen, Norway, Kalfarveien 31, 5018 Bergen, Norway Zakariassen et al. Scandinavian Journal of Tra...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "The STRS (shortness of breath, tremulousness, racing heart, and sweating): A brief checklist for acute distress with panic-like autonomic indicators; development and factor structure" ppt
... of a parent Table 3: Factor loadings and final communality estimates for each item Latent Variable STRS Item Factor 1 Factor 2 Final Communality Estimate Acute Autonomic Activation Indicators ... Haynes - sneil@hawaii.edu; Edward S Kubany - Edward.Kubany@med.va.gov; Tyler C Ralston - Tyler.Ralston@med.va.gov; Jennifer M Yamashita - Jennifer.Matsukawa@med.va.gov * Corresponding author ......
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "The 5th annual European League Against Rheumatism congress in Berlin: a personal perspective" ppsx
... the education program coordinator and accountant. One must admire the efficiency of this secretariat and congratulate EULAR on having such an able managing team. After 20 years in a small office, ... EULAR journal Annals of the Rheumatic Diseases, and also access to all educational events, unlike the American College of Rheumatology (ACR), which charges extra for these benefits. The biennia...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx
... Hilden, Germany) followed by Polymyxin B Sepharose adsorption (BioRad, Hercules, CA, USA) and anion exchange chromatography on DEAE Sepha- rose (Pharmacia, Uppsala, Sweden) essentially as described [27]. ... measured after an additional 16 hours. The increase in proliferation was statistically significant for all supernatants examined (indicated by a star). Arthritis Research & Therapy...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Controlled meal frequency without caloric restriction alters peripheral blood mononuclear cell cytokine production" potx
... Matsuda M, Nishizawa M, Segawa K, Tanaka M, Kishimoto K, Matsuki Y, Murakami M, Ichisaka T, Murakami H, Watanabe E, Takagi T, Akiyoshi M, Ohtsubo T, Kihara S, Yamashita S, Makishima M, Funahashi ... using the Applied Biosystems GeneAmp 7700 Sequence Detector. Statistical Analysis Data are presented as the mean and SEM. An analysis of variance appropriate for a 2 peri od crossover study wit...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "The management of acute parathyroid crisis secondary to parathyroid carcinoma: a case report" pdf
... of all reported cases of primary hyperparathyroidism. Case presentation: We report the case of a 60-year-old Caucasian man with hypercalcaemic hyperpa rathyroid crisis associated with parathyroid ... 4:28 http://www.jmedicalcasereports.com/content/4/1/28 Page 2 of 5 CASE REPO R T Open Access The management of acute parathyroid crisis secondary to parathyroid carcinoma: a case repo...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: "The relaxation exercise and social support trialresst: study protocol for a randomized community based trial" potx
... GHQ-12. Moreover, multivariate analysis showed that mental distress was significantly associated with reported abnormal vaginal discharge, after adjusting for relevant risk factors and reported RTIs ... Clougherty KF, Wickramaratne P, et al: Group interpersonal psychotherapy for depression in rural Uganda: a randomized controlled trial. JAMA 2003, 289:3117-24. 36. Mynors-Wallis L, Gath DH,...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx
... Sanna S, Maschio A, Busonero F, Usala G, Mulas A, Lai S, Dei M, Orrù M, Albai G, Bandinelli S, Schlessinger D, Lakatta E, Scuteri A, Najjar SS, Guralnik J, Naitza S, Crisponi L, Cao A, Abecasis ... variants, only P321L has been tested for association with gout in an Asian- 21 Table 2 Association analysis of rs3733591 with gout in NZ Māori, East Polynesian, West Polynesian and Caucasi...
Ngày tải lên: 12/08/2014, 15:23
Báo cáo y học: " The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging" potx
... SmaI-SphI sites of pALTER. Muta- genesis was carried out using the mutagenic oligonucle- otide (5'-GTTTGTGCTCTTAACAGAACT GGGAAAGTACTTGATAAACCTTTATCTTGTAGAGAGG), to precisely delete amino acids ... boiled for 3 minutes, separated by SDS PAGE gel (12% acrylamide), and visualized by fluorography or analyzed by phosphor- imaging using The Discovery Series Quantity One (Bio- Rad, Hercules,...
Ngày tải lên: 13/08/2014, 09:21