Báo cáo y học: "The skiers knee without swelling or instability, a difficult diagnosis: a case report" potx
Báo cáo y học: "The skiers knee without swelling or instability, a difficult diagnosis: a case report" potx
... Medical Case ReportsOpen Access Case reportThe skiers knee without swelling or instability, a difficult diagnosis: a case reportMark E O'Donnell*1,4, Stephen A Badger1, David Campbell2, ... higher rate occurs among skiers aged 55–64 wheninjury analysis is completed correlating for the actualnumber of participants for each age group [1].The clinical history of knee injury in skiers ... Loan - wloan@doctors.org.uk; Brendan Sinnott - brendan.sinnott@bch.n-i.nhs.uk* Corresponding author AbstractSkiing as a recreational activity has increased exponentially in the last twenty-years....
- 4
- 233
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... possibleNACA 5 Acute vital (life threatening) dangerNACA 6 Acute cardiac or respiratory arrestNACA 7 DeathZakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... erik.zakariassen@isf.uib.no1National Centre for Emergency Primary Health Care, Uni Health, Bergen,Norway, Kalfarveien 31, 5018 Bergen, NorwayZakariassen et al. Scandinavian Journal of Trauma, ... codingBased on all available information according to TheNational Committee on Aeronautics (NACA) ScoreSystem [17], the severity of the medical problem wasclassified (table 2).The NACA score system...
- 9
- 784
- 0
Báo cáo y học: "The STRS (shortness of breath, tremulousness, racing heart, and sweating): A brief checklist for acute distress with panic-like autonomic indicators; development and factor structure" ppt
... of a parentTable 3: Factor loadings and final communality estimates for each itemLatent Variable STRS Item Factor 1 Factor 2 Final Communality EstimateAcute Autonomic Activation Indicators ... Haynes - sneil@hawaii.edu; Edward S Kubany - Edward.Kubany@med.va.gov; Tyler C Ralston - Tyler.Ralston@med.va.gov; Jennifer M Yamashita - Jennifer.Matsukawa@med.va.gov* Corresponding author ... Edward S Kubany1, Tyler C Ralston1 and Jennifer M Yamashita1Address: 1National Center for PTSD, Department of Veterans Affairs, Pacific Islands Health Care System, Spark M. Matsunaga...
- 8
- 491
- 0
Báo cáo y học: "The 5th annual European League Against Rheumatism congress in Berlin: a personal perspective" ppsx
... the education program coordinatorand accountant. One must admire the efficiency of thissecretariat and congratulate EULAR on having such anable managing team. After 20 years in a small office, ... EULARjournal Annals of the Rheumatic Diseases, and alsoaccess to all educational events, unlike the AmericanCollege of Rheumatology (ACR), which charges extra forthese benefits. The biennial ... tostage top abstracts in a mixed topic session, but then oneshould give the session features of a plenary. The ACRhas for years practised this at their annual meetings, andthe plenary sessions...
- 4
- 263
- 0
Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx
... Hilden, Germany) followedby Polymyxin B Sepharose adsorption (BioRad, Hercules, CA,USA) and anion exchange chromatography on DEAE Sepha-rose (Pharmacia, Uppsala, Sweden) essentially as described[27]. ... measured after an additional 16 hours. The increase in proliferation was statistically significant for all supernatants examined (indicated by a star).Arthritis Research & Therapy Vol 8 No 4 ... erythematosus (SLE) is an autoimmune dis-ease characterized by a wide spectrum of multi-organ manifes-tations, and genetic, hormonal, environmental andimmunoregulatory factors are known to contribute...
- 10
- 395
- 0
Báo cáo y học: "Controlled meal frequency without caloric restriction alters peripheral blood mononuclear cell cytokine production" potx
... Matsuda M, Nishizawa M, Segawa K, Tanaka M, Kishimoto K,Matsuki Y, Murakami M, Ichisaka T, Murakami H, Watanabe E, Takagi T,Akiyoshi M, Ohtsubo T, Kihara S, Yamashita S, Makishima M, Funahashi ... usingthe Applied Biosystems GeneAmp 7700 SequenceDetector.Statistical AnalysisData are presented as the mean and SEM. An analysis ofvariance appropriate for a 2 peri od crossover study withrepeated ... serumvisfatin, a novel adipocytokine, which is synthesizedmainly by viscera l adipocytes and serve s as an insulinmimetic and proinflammatory cytokine [31-33]. Similarto other proinflammmatory markers,...
- 13
- 246
- 0
Báo cáo y học: "The management of acute parathyroid crisis secondary to parathyroid carcinoma: a case report" pdf
... of all reportedcases of primary hyperparathyroidism. Case presentation: We report the case of a 60-year-old Caucasian man with hypercalcaemic hyperpa rathyroidcrisis associated with parathyroid ... 4:28http://www.jmedicalcasereports.com/content/4/1/28Page 2 of 5 CASE REPO R T Open AccessThe management of acute parathyroid crisissecondary to parathyroid carcinoma: a case reportKathy Rock*, Nariman Fattah, Diarmuid O’Malley, Enda McDermottAbstractIntroduction: ... McDermottAbstractIntroduction: Hypercalcaemic hyperparathyroid crisis is a rare but life-threatening complication of primaryhyperparathyroidism. Parathyroid carcinoma is a rare malignancy with an...
- 5
- 262
- 0
Báo cáo y học: "The relaxation exercise and social support trialresst: study protocol for a randomized community based trial" potx
... GHQ-12. Moreover, multivariateanalysis showed that mental distress was significantlyassociated with reported abnormal vaginal discharge,after adjusting for relevant risk factors and reportedRTIs ... Clougherty KF, Wickramaratne P,et al: Group interpersonal psychotherapy for depression in rural Uganda: a randomized controlled trial. JAMA 2003, 289:3117-24.36. Mynors-Wallis L, Gath DH, Day A, Baker ... Paraje G, Sharan P, Karam G, Sadana R: The 10/90 divide inmental health research: trends over a 10-year period. Br J Psychiatry 2006,188:81-2.30. Araya R, Rojas G, Fritsch R, Gaete J, Rojas...
- 8
- 569
- 0
Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx
... Sanna S, Maschio A, Busonero F, Usala G, Mulas A, Lai S, Dei M, Orrù M, Albai G, Bandinelli S, Schlessinger D, Lakatta E, Scuteri A, Najjar SS, Guralnik J, Naitza S, Crisponi L, Cao A, Abecasis ... variants, only P321L has been tested for association with gout in an Asian- 21Table 2 Association analysis of rs3733591 with gout in NZ Māori, East Polynesian, West Polynesian and Caucasian ... Roddi Laurence, Karen Lindsay, Maria Lobo, Karen Pui and Gabrielle Sexton are thanked for assistance in recruitment. Mik Black is thanked for his assistance with statistical analysis. The Framingham...
- 25
- 266
- 0
Báo cáo y học: " The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging" potx
... SmaI-SphI sites of pALTER. Muta-genesis was carried out using the mutagenic oligonucle-otide (5'-GTTTGTGCTCTTAACAGAACTGGGAAAGTACTTGATAAACCTTTATCTTGTAGAGAGG),to precisely delete amino acids ... boiled for 3minutes, separated by SDS PAGE gel (12% acrylamide),and visualized by fluorography or analyzed by phosphor-imaging using The Discovery Series Quantity One (Bio-Rad, Hercules, CA).Steady ... wild-type. Second, these mutant procapsids, likewild-type, associated with intracellular membranes as hasbeen described as a normal transport pathway for severalretroviruses [33,38,39]. Finally,...
- 14
- 254
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo giáo dục thể chất trường tiểu họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ